FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632061_at:

>probe:Drosophila_2:1632061_at:679:451; Interrogation_Position=1033; Antisense; GATCTGGACGACGTGAGCACCACAT
>probe:Drosophila_2:1632061_at:203:519; Interrogation_Position=1106; Antisense; GTGGTGCAGTCGGACCCATTAGGAC
>probe:Drosophila_2:1632061_at:616:175; Interrogation_Position=1141; Antisense; AAACCGTCGGCGGATGTCTGGCGTC
>probe:Drosophila_2:1632061_at:258:567; Interrogation_Position=628; Antisense; GGCAAAAATCCCACCGAATTATTCG
>probe:Drosophila_2:1632061_at:16:695; Interrogation_Position=658; Antisense; TTTGCCGCTGCAGGTGGAAATCACT
>probe:Drosophila_2:1632061_at:178:521; Interrogation_Position=671; Antisense; GTGGAAATCACTTTGCACCCAGCGG
>probe:Drosophila_2:1632061_at:75:355; Interrogation_Position=685; Antisense; GCACCCAGCGGTCATAGTTTCAATC
>probe:Drosophila_2:1632061_at:45:681; Interrogation_Position=784; Antisense; TATGGCAGCTACAGTGATCTACCCT
>probe:Drosophila_2:1632061_at:294:513; Interrogation_Position=797; Antisense; GTGATCTACCCTGGCTGAGGAACGC
>probe:Drosophila_2:1632061_at:673:619; Interrogation_Position=828; Antisense; TGCGGCGGCCGCGAATATAAATCCC
>probe:Drosophila_2:1632061_at:14:31; Interrogation_Position=844; Antisense; ATAAATCCCGGCCAGGAGAACTCCG
>probe:Drosophila_2:1632061_at:106:233; Interrogation_Position=889; Antisense; AATCCCGATCACGATGGCGTTAACC
>probe:Drosophila_2:1632061_at:408:293; Interrogation_Position=906; Antisense; CGTTAACCTGATCAAGCGCTGTGTC
>probe:Drosophila_2:1632061_at:526:123; Interrogation_Position=920; Antisense; AGCGCTGTGTCACACTGATAACCCA

Paste this into a BLAST search page for me
GATCTGGACGACGTGAGCACCACATGTGGTGCAGTCGGACCCATTAGGACAAACCGTCGGCGGATGTCTGGCGTCGGCAAAAATCCCACCGAATTATTCGTTTGCCGCTGCAGGTGGAAATCACTGTGGAAATCACTTTGCACCCAGCGGGCACCCAGCGGTCATAGTTTCAATCTATGGCAGCTACAGTGATCTACCCTGTGATCTACCCTGGCTGAGGAACGCTGCGGCGGCCGCGAATATAAATCCCATAAATCCCGGCCAGGAGAACTCCGAATCCCGATCACGATGGCGTTAACCCGTTAACCTGATCAAGCGCTGTGTCAGCGCTGTGTCACACTGATAACCCA

Full Affymetrix probeset data:

Annotations for 1632061_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720