Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632062_s_at:

>probe:Drosophila_2:1632062_s_at:423:31; Interrogation_Position=109; Antisense; ATAAACTCGGTCCTGCCCTATTTGG
>probe:Drosophila_2:1632062_s_at:364:625; Interrogation_Position=122; Antisense; TGCCCTATTTGGTGGACAGGTCCCG
>probe:Drosophila_2:1632062_s_at:610:79; Interrogation_Position=176; Antisense; AGGTCTCCCACAAGGGCATCAAAAT
>probe:Drosophila_2:1632062_s_at:80:33; Interrogation_Position=193; Antisense; ATCAAAATCGTCCAGGGTGCCTCGA
>probe:Drosophila_2:1632062_s_at:538:531; Interrogation_Position=207; Antisense; GGGTGCCTCGAAGCATCTGATTCCA
>probe:Drosophila_2:1632062_s_at:146:605; Interrogation_Position=224; Antisense; TGATTCCACACAGTGCCATAACCAG
>probe:Drosophila_2:1632062_s_at:63:661; Interrogation_Position=242; Antisense; TAACCAGCTCGGTGCAGACTGACGA
>probe:Drosophila_2:1632062_s_at:349:105; Interrogation_Position=257; Antisense; AGACTGACGACATCGTCGCCTGCGT
>probe:Drosophila_2:1632062_s_at:250:621; Interrogation_Position=26; Antisense; TGCGTCGCGACGTGCAGAAGGCCTC
>probe:Drosophila_2:1632062_s_at:465:669; Interrogation_Position=331; Antisense; TACCGCTGCGACTCGGAGACGACGG
>probe:Drosophila_2:1632062_s_at:229:131; Interrogation_Position=392; Antisense; ACCGGCCCGACAATCAGAAGCGTTT
>probe:Drosophila_2:1632062_s_at:365:109; Interrogation_Position=41; Antisense; AGAAGGCCTCCTACTATGTGTGGTT
>probe:Drosophila_2:1632062_s_at:107:147; Interrogation_Position=53; Antisense; ACTATGTGTGGTTCCTGGGCGCCGA
>probe:Drosophila_2:1632062_s_at:93:439; Interrogation_Position=95; Antisense; GAGGCGCCCGCGTCATAAACTCGGT

Paste this into a BLAST search page for me
ATAAACTCGGTCCTGCCCTATTTGGTGCCCTATTTGGTGGACAGGTCCCGAGGTCTCCCACAAGGGCATCAAAATATCAAAATCGTCCAGGGTGCCTCGAGGGTGCCTCGAAGCATCTGATTCCATGATTCCACACAGTGCCATAACCAGTAACCAGCTCGGTGCAGACTGACGAAGACTGACGACATCGTCGCCTGCGTTGCGTCGCGACGTGCAGAAGGCCTCTACCGCTGCGACTCGGAGACGACGGACCGGCCCGACAATCAGAAGCGTTTAGAAGGCCTCCTACTATGTGTGGTTACTATGTGTGGTTCCTGGGCGCCGAGAGGCGCCCGCGTCATAAACTCGGT

Full Affymetrix probeset data:

Annotations for 1632062_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime