Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632064_at:

>probe:Drosophila_2:1632064_at:537:393; Interrogation_Position=1060; Antisense; GAAATGGCTGTTCCGCGCATGCATC
>probe:Drosophila_2:1632064_at:614:623; Interrogation_Position=1103; Antisense; TGCCCGGCGGACAGCTCAAAAAGTC
>probe:Drosophila_2:1632064_at:426:167; Interrogation_Position=1146; Antisense; AAATGCGTGGCTGGCGTACGAGTCC
>probe:Drosophila_2:1632064_at:203:595; Interrogation_Position=1184; Antisense; TGGGCATGCTCCGTGACCTGAAGGA
>probe:Drosophila_2:1632064_at:374:589; Interrogation_Position=1220; Antisense; TGGATACCACCTTCTGCGAGCAGCT
>probe:Drosophila_2:1632064_at:550:335; Interrogation_Position=1242; Antisense; GCTCCAAGTGGCCAACTACGGTGTG
>probe:Drosophila_2:1632064_at:220:147; Interrogation_Position=1274; Antisense; ACTACGAGCCGCACTGGGATTTCTT
>probe:Drosophila_2:1632064_at:508:133; Interrogation_Position=1304; Antisense; ACCCCAATCATTATCCGGCGGAGGA
>probe:Drosophila_2:1632064_at:22:313; Interrogation_Position=1342; Antisense; GCCACTGCCATATTTTATCTATCCG
>probe:Drosophila_2:1632064_at:572:585; Interrogation_Position=1403; Antisense; TGGACATCGCCGTGAAGCCGCAGCT
>probe:Drosophila_2:1632064_at:161:593; Interrogation_Position=1427; Antisense; TGGGCAACGTTCTCTTCTGGTACAA
>probe:Drosophila_2:1632064_at:579:467; Interrogation_Position=1496; Antisense; GTTGTCCAGTGCTCAAGGGCAGCAA
>probe:Drosophila_2:1632064_at:175:545; Interrogation_Position=1538; Antisense; GGATACACGAGGTGACCCAGACCTT
>probe:Drosophila_2:1632064_at:231:409; Interrogation_Position=1576; Antisense; GACGTTTTCCGGGATCACGAGGTGT

Paste this into a BLAST search page for me
GAAATGGCTGTTCCGCGCATGCATCTGCCCGGCGGACAGCTCAAAAAGTCAAATGCGTGGCTGGCGTACGAGTCCTGGGCATGCTCCGTGACCTGAAGGATGGATACCACCTTCTGCGAGCAGCTGCTCCAAGTGGCCAACTACGGTGTGACTACGAGCCGCACTGGGATTTCTTACCCCAATCATTATCCGGCGGAGGAGCCACTGCCATATTTTATCTATCCGTGGACATCGCCGTGAAGCCGCAGCTTGGGCAACGTTCTCTTCTGGTACAAGTTGTCCAGTGCTCAAGGGCAGCAAGGATACACGAGGTGACCCAGACCTTGACGTTTTCCGGGATCACGAGGTGT

Full Affymetrix probeset data:

Annotations for 1632064_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime