Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632070_at:

>probe:Drosophila_2:1632070_at:262:607; Interrogation_Position=1166; Antisense; TGATGATCCAGCATGCAGTGCCGCA
>probe:Drosophila_2:1632070_at:223:97; Interrogation_Position=1190; Antisense; AGATAGACATCCTGGCGCATCCGAG
>probe:Drosophila_2:1632070_at:454:345; Interrogation_Position=1206; Antisense; GCATCCGAGAGTCAAGGCTTTCCTA
>probe:Drosophila_2:1632070_at:708:367; Interrogation_Position=1272; Antisense; GAATGTGCCCATTCTGGGATTGCCC
>probe:Drosophila_2:1632070_at:683:541; Interrogation_Position=1288; Antisense; GGATTGCCCCTATTCCAGCATGAAG
>probe:Drosophila_2:1632070_at:512:383; Interrogation_Position=1317; Antisense; GAACATGGAGCTAGCCGTGCGATTA
>probe:Drosophila_2:1632070_at:615:195; Interrogation_Position=1390; Antisense; AACTGGGCAGTGGACAGGCTACTCC
>probe:Drosophila_2:1632070_at:420:47; Interrogation_Position=1438; Antisense; ATCCGGGATGTGTCTCTGGAGTTCA
>probe:Drosophila_2:1632070_at:562:123; Interrogation_Position=1489; Antisense; AGCGCTCTCTTCTGGGTGAACTATG
>probe:Drosophila_2:1632070_at:421:531; Interrogation_Position=1502; Antisense; GGGTGAACTATGTGGCCCGGCACAA
>probe:Drosophila_2:1632070_at:493:413; Interrogation_Position=1588; Antisense; GACCTCTTCGTGTTCTATGCCGGAA
>probe:Drosophila_2:1632070_at:391:673; Interrogation_Position=1603; Antisense; TATGCCGGAATAGCTACTTTAGTCG
>probe:Drosophila_2:1632070_at:42:501; Interrogation_Position=1624; Antisense; GTCGTAAGCTTACTGGTGGCCCTGA
>probe:Drosophila_2:1632070_at:710:317; Interrogation_Position=1642; Antisense; GCCCTGAGTTTTGGCGGCTTTTATA

Paste this into a BLAST search page for me
TGATGATCCAGCATGCAGTGCCGCAAGATAGACATCCTGGCGCATCCGAGGCATCCGAGAGTCAAGGCTTTCCTAGAATGTGCCCATTCTGGGATTGCCCGGATTGCCCCTATTCCAGCATGAAGGAACATGGAGCTAGCCGTGCGATTAAACTGGGCAGTGGACAGGCTACTCCATCCGGGATGTGTCTCTGGAGTTCAAGCGCTCTCTTCTGGGTGAACTATGGGGTGAACTATGTGGCCCGGCACAAGACCTCTTCGTGTTCTATGCCGGAATATGCCGGAATAGCTACTTTAGTCGGTCGTAAGCTTACTGGTGGCCCTGAGCCCTGAGTTTTGGCGGCTTTTATA

Full Affymetrix probeset data:

Annotations for 1632070_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime