FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632071_at:

>probe:Drosophila_2:1632071_at:252:219; Interrogation_Position=1038; Antisense; AAGTCCATTTATCGACAGCGACAGC
>probe:Drosophila_2:1632071_at:676:301; Interrogation_Position=487; Antisense; CCCGATCGGGCTATTGTGAATGGAA
>probe:Drosophila_2:1632071_at:298:401; Interrogation_Position=515; Antisense; GACAGTACGCTCCTCTTTATATGGA
>probe:Drosophila_2:1632071_at:342:675; Interrogation_Position=605; Antisense; TAGCACTCGTGCGTCTTAAGTTTCC
>probe:Drosophila_2:1632071_at:578:707; Interrogation_Position=620; Antisense; TTAAGTTTCCTGTGCGCTATACGAG
>probe:Drosophila_2:1632071_at:204:27; Interrogation_Position=638; Antisense; ATACGAGAGCCATCCAACCTATTTG
>probe:Drosophila_2:1632071_at:26:277; Interrogation_Position=656; Antisense; CTATTTGCCTTCCAAGAGCCCAAAA
>probe:Drosophila_2:1632071_at:183:323; Interrogation_Position=696; Antisense; GCGAAAGTTTCAAGCATCCGGCTGG
>probe:Drosophila_2:1632071_at:555:47; Interrogation_Position=711; Antisense; ATCCGGCTGGCCAGACATGGGACAA
>probe:Drosophila_2:1632071_at:331:219; Interrogation_Position=744; Antisense; AAGTGAGGTACTCTTGCGCAGCTTC
>probe:Drosophila_2:1632071_at:527:43; Interrogation_Position=769; Antisense; ATCGCGGAACGGCATCCAGATGTGT
>probe:Drosophila_2:1632071_at:311:65; Interrogation_Position=848; Antisense; ATGGGAATGACACCAGTCCCGGCGA
>probe:Drosophila_2:1632071_at:522:317; Interrogation_Position=931; Antisense; GCCGGCATAATCTCCTACGGACAGA
>probe:Drosophila_2:1632071_at:307:557; Interrogation_Position=949; Antisense; GGACAGAAGCCCTGCGTACTTAAAA

Paste this into a BLAST search page for me
AAGTCCATTTATCGACAGCGACAGCCCCGATCGGGCTATTGTGAATGGAAGACAGTACGCTCCTCTTTATATGGATAGCACTCGTGCGTCTTAAGTTTCCTTAAGTTTCCTGTGCGCTATACGAGATACGAGAGCCATCCAACCTATTTGCTATTTGCCTTCCAAGAGCCCAAAAGCGAAAGTTTCAAGCATCCGGCTGGATCCGGCTGGCCAGACATGGGACAAAAGTGAGGTACTCTTGCGCAGCTTCATCGCGGAACGGCATCCAGATGTGTATGGGAATGACACCAGTCCCGGCGAGCCGGCATAATCTCCTACGGACAGAGGACAGAAGCCCTGCGTACTTAAAA

Full Affymetrix probeset data:

Annotations for 1632071_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720