Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632073_at:

>probe:Drosophila_2:1632073_at:619:555; Interrogation_Position=4680; Antisense; GGACGAGATTGATGCACCCAGTAAG
>probe:Drosophila_2:1632073_at:594:413; Interrogation_Position=4794; Antisense; GACCAAAAATGCTGTCCGGCGACAA
>probe:Drosophila_2:1632073_at:652:431; Interrogation_Position=4833; Antisense; GAGTCTCACAAAAACGCCTATCGTT
>probe:Drosophila_2:1632073_at:39:453; Interrogation_Position=4906; Antisense; GATCAGTTCGATCCCAGATACCGAC
>probe:Drosophila_2:1632073_at:10:97; Interrogation_Position=4921; Antisense; AGATACCGACTCTATGCTGTTGTGT
>probe:Drosophila_2:1632073_at:495:639; Interrogation_Position=4951; Antisense; TCGGGCATGCTGAACGGAGGTCACT
>probe:Drosophila_2:1632073_at:212:495; Interrogation_Position=4970; Antisense; GTCACTACATTTCCTATGCTTCGAA
>probe:Drosophila_2:1632073_at:592:195; Interrogation_Position=4998; Antisense; AACTGGTTCCTGGTACTGCTATAAC
>probe:Drosophila_2:1632073_at:245:163; Interrogation_Position=5039; Antisense; AAATATCCCAGAAGCCGGTCATCGA
>probe:Drosophila_2:1632073_at:563:537; Interrogation_Position=5055; Antisense; GGTCATCGATCCAAGTGCTGCATAT
>probe:Drosophila_2:1632073_at:293:335; Interrogation_Position=5071; Antisense; GCTGCATATCTGCTGTTCTACGAAC
>probe:Drosophila_2:1632073_at:375:685; Interrogation_Position=5086; Antisense; TTCTACGAACGCAAGGGCCTGGACT
>probe:Drosophila_2:1632073_at:290:585; Interrogation_Position=5105; Antisense; TGGACTACGAGCCTTACCTACCGAA
>probe:Drosophila_2:1632073_at:272:377; Interrogation_Position=5199; Antisense; GAAGAAGCTGTGCTCAATTTCCTAA

Paste this into a BLAST search page for me
GGACGAGATTGATGCACCCAGTAAGGACCAAAAATGCTGTCCGGCGACAAGAGTCTCACAAAAACGCCTATCGTTGATCAGTTCGATCCCAGATACCGACAGATACCGACTCTATGCTGTTGTGTTCGGGCATGCTGAACGGAGGTCACTGTCACTACATTTCCTATGCTTCGAAAACTGGTTCCTGGTACTGCTATAACAAATATCCCAGAAGCCGGTCATCGAGGTCATCGATCCAAGTGCTGCATATGCTGCATATCTGCTGTTCTACGAACTTCTACGAACGCAAGGGCCTGGACTTGGACTACGAGCCTTACCTACCGAAGAAGAAGCTGTGCTCAATTTCCTAA

Full Affymetrix probeset data:

Annotations for 1632073_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime