Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632074_at:

>probe:Drosophila_2:1632074_at:699:287; Interrogation_Position=1208; Antisense; CTGGCATCAGTCTGGCCCGGGTCAT
>probe:Drosophila_2:1632074_at:660:577; Interrogation_Position=1221; Antisense; GGCCCGGGTCATCCAAATGCAGAAT
>probe:Drosophila_2:1632074_at:347:231; Interrogation_Position=1258; Antisense; AATGTTGCCGCCGTGCTCAGTGCAG
>probe:Drosophila_2:1632074_at:412:619; Interrogation_Position=1271; Antisense; TGCTCAGTGCAGCAGCCAACAGCGG
>probe:Drosophila_2:1632074_at:407:189; Interrogation_Position=1370; Antisense; AACAGGTGCTTTCGCAACGGTCGGA
>probe:Drosophila_2:1632074_at:333:181; Interrogation_Position=1394; Antisense; AAAAGTCGGCGAATGGCTCCTCGAA
>probe:Drosophila_2:1632074_at:26:117; Interrogation_Position=1436; Antisense; AGCATCACAGCGATCACAGCCCGGA
>probe:Drosophila_2:1632074_at:154:301; Interrogation_Position=1461; Antisense; CGCCAAGCGGCGGATACACAAGTGC
>probe:Drosophila_2:1632074_at:195:161; Interrogation_Position=1478; Antisense; ACAAGTGCCAATTTCTCGGCTGCAA
>probe:Drosophila_2:1632074_at:474:715; Interrogation_Position=1490; Antisense; TTCTCGGCTGCAAAAAAGTCTACAC
>probe:Drosophila_2:1632074_at:295:219; Interrogation_Position=1505; Antisense; AAGTCTACACGAAGAGTTCGCACCT
>probe:Drosophila_2:1632074_at:102:375; Interrogation_Position=1515; Antisense; GAAGAGTTCGCACCTGAAGGCCCAC
>probe:Drosophila_2:1632074_at:294:371; Interrogation_Position=1530; Antisense; GAAGGCCCACCAAAGAACGCATACA
>probe:Drosophila_2:1632074_at:574:279; Interrogation_Position=1548; Antisense; GCATACAGCGTGTGCCCCGGGAAAG

Paste this into a BLAST search page for me
CTGGCATCAGTCTGGCCCGGGTCATGGCCCGGGTCATCCAAATGCAGAATAATGTTGCCGCCGTGCTCAGTGCAGTGCTCAGTGCAGCAGCCAACAGCGGAACAGGTGCTTTCGCAACGGTCGGAAAAAGTCGGCGAATGGCTCCTCGAAAGCATCACAGCGATCACAGCCCGGACGCCAAGCGGCGGATACACAAGTGCACAAGTGCCAATTTCTCGGCTGCAATTCTCGGCTGCAAAAAAGTCTACACAAGTCTACACGAAGAGTTCGCACCTGAAGAGTTCGCACCTGAAGGCCCACGAAGGCCCACCAAAGAACGCATACAGCATACAGCGTGTGCCCCGGGAAAG

Full Affymetrix probeset data:

Annotations for 1632074_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime