Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632075_at:

>probe:Drosophila_2:1632075_at:33:47; Interrogation_Position=143; Antisense; ATCCCTATCACCATCAGCATCCTGG
>probe:Drosophila_2:1632075_at:499:115; Interrogation_Position=158; Antisense; AGCATCCTGGCCAAGTGGCGCTAAG
>probe:Drosophila_2:1632075_at:265:447; Interrogation_Position=16; Antisense; GATGCTCGCCGGCAGAAACGACTTG
>probe:Drosophila_2:1632075_at:635:43; Interrogation_Position=161; Antisense; ATCCTGGCCAAGTGGCGCTAAGTCG
>probe:Drosophila_2:1632075_at:431:221; Interrogation_Position=170; Antisense; AAGTGGCGCTAAGTCGCTCCTGGGC
>probe:Drosophila_2:1632075_at:429:339; Interrogation_Position=177; Antisense; GCTAAGTCGCTCCTGGGCGCTGTAA
>probe:Drosophila_2:1632075_at:559:345; Interrogation_Position=27; Antisense; GCAGAAACGACTTGGCCCAGCGCCA
>probe:Drosophila_2:1632075_at:170:197; Interrogation_Position=32; Antisense; AACGACTTGGCCCAGCGCCAATTGC
>probe:Drosophila_2:1632075_at:454:123; Interrogation_Position=45; Antisense; AGCGCCAATTGCATCCTTCGAGAAG
>probe:Drosophila_2:1632075_at:506:311; Interrogation_Position=48; Antisense; GCCAATTGCATCCTTCGAGAAGTCA
>probe:Drosophila_2:1632075_at:577:373; Interrogation_Position=66; Antisense; GAAGTCATTCGAGGACAATGCCACG
>probe:Drosophila_2:1632075_at:402:497; Interrogation_Position=69; Antisense; GTCATTCGAGGACAATGCCACGACA
>probe:Drosophila_2:1632075_at:716:437; Interrogation_Position=76; Antisense; GAGGACAATGCCACGACAAATGCAC
>probe:Drosophila_2:1632075_at:145:49; Interrogation_Position=83; Antisense; ATGCCACGACAAATGCACAGCAGCA

Paste this into a BLAST search page for me
ATCCCTATCACCATCAGCATCCTGGAGCATCCTGGCCAAGTGGCGCTAAGGATGCTCGCCGGCAGAAACGACTTGATCCTGGCCAAGTGGCGCTAAGTCGAAGTGGCGCTAAGTCGCTCCTGGGCGCTAAGTCGCTCCTGGGCGCTGTAAGCAGAAACGACTTGGCCCAGCGCCAAACGACTTGGCCCAGCGCCAATTGCAGCGCCAATTGCATCCTTCGAGAAGGCCAATTGCATCCTTCGAGAAGTCAGAAGTCATTCGAGGACAATGCCACGGTCATTCGAGGACAATGCCACGACAGAGGACAATGCCACGACAAATGCACATGCCACGACAAATGCACAGCAGCA

Full Affymetrix probeset data:

Annotations for 1632075_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime