Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632076_a_at:

>probe:Drosophila_2:1632076_a_at:233:563; Interrogation_Position=1004; Antisense; GGAATAACCGGATCATGTCCCACCA
>probe:Drosophila_2:1632076_a_at:19:253; Interrogation_Position=1069; Antisense; CAAAATTCCCGATTACGCCATTTGT
>probe:Drosophila_2:1632076_a_at:145:407; Interrogation_Position=1099; Antisense; GACGGCTAGTACATGAGCATCTCCT
>probe:Drosophila_2:1632076_a_at:37:499; Interrogation_Position=1132; Antisense; GTCTGTTTGCCGAGATACCTTTTAT
>probe:Drosophila_2:1632076_a_at:608:135; Interrogation_Position=647; Antisense; ACGAATCCGTGCACCGGCGAAGATT
>probe:Drosophila_2:1632076_a_at:400:559; Interrogation_Position=680; Antisense; GGAAACTCTGACCAGTTCACTGTTG
>probe:Drosophila_2:1632076_a_at:268:173; Interrogation_Position=743; Antisense; AAAGCAGCAGATCCACTTACTGTAA
>probe:Drosophila_2:1632076_a_at:564:21; Interrogation_Position=786; Antisense; ATAGGTACGTTTCTGATGGTGTCAC
>probe:Drosophila_2:1632076_a_at:490:65; Interrogation_Position=801; Antisense; ATGGTGTCACCTGCTATGGGTACTA
>probe:Drosophila_2:1632076_a_at:68:65; Interrogation_Position=816; Antisense; ATGGGTACTACTACTGTGCAGCAGT
>probe:Drosophila_2:1632076_a_at:43:177; Interrogation_Position=841; Antisense; AAACGCCACTGGCTATTGGAACCAA
>probe:Drosophila_2:1632076_a_at:60:687; Interrogation_Position=854; Antisense; TATTGGAACCAATGTCCCACCGGTA
>probe:Drosophila_2:1632076_a_at:573:131; Interrogation_Position=872; Antisense; ACCGGTACCCAATTCAATGCTGGCA
>probe:Drosophila_2:1632076_a_at:557:689; Interrogation_Position=917; Antisense; TTTGTCTGTACCCATAACCGATGTG

Paste this into a BLAST search page for me
GGAATAACCGGATCATGTCCCACCACAAAATTCCCGATTACGCCATTTGTGACGGCTAGTACATGAGCATCTCCTGTCTGTTTGCCGAGATACCTTTTATACGAATCCGTGCACCGGCGAAGATTGGAAACTCTGACCAGTTCACTGTTGAAAGCAGCAGATCCACTTACTGTAAATAGGTACGTTTCTGATGGTGTCACATGGTGTCACCTGCTATGGGTACTAATGGGTACTACTACTGTGCAGCAGTAAACGCCACTGGCTATTGGAACCAATATTGGAACCAATGTCCCACCGGTAACCGGTACCCAATTCAATGCTGGCATTTGTCTGTACCCATAACCGATGTG

Full Affymetrix probeset data:

Annotations for 1632076_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime