FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632077_at:

>probe:Drosophila_2:1632077_at:140:325; Interrogation_Position=3140; Antisense; GCGATACTCCAAGCCGTACATGTTT
>probe:Drosophila_2:1632077_at:496:151; Interrogation_Position=3157; Antisense; ACATGTTTACGGGAATCCTGCCAAT
>probe:Drosophila_2:1632077_at:42:175; Interrogation_Position=3212; Antisense; AAAGCCCCTGCTTATAGGACAACTA
>probe:Drosophila_2:1632077_at:232:17; Interrogation_Position=3245; Antisense; ATTTTCTGAGACCTTGACTACCTAC
>probe:Drosophila_2:1632077_at:54:403; Interrogation_Position=3260; Antisense; GACTACCTACGATGATGGCGACTTT
>probe:Drosophila_2:1632077_at:570:401; Interrogation_Position=3279; Antisense; GACTTTTGCCGCATTCGACTTAACA
>probe:Drosophila_2:1632077_at:8:677; Interrogation_Position=3319; Antisense; TAGAGATTGTCTGCGTCACCAAGAA
>probe:Drosophila_2:1632077_at:420:53; Interrogation_Position=3390; Antisense; ATGCTACTCAATGATCTGCGCGGTC
>probe:Drosophila_2:1632077_at:408:329; Interrogation_Position=3409; Antisense; GCGGTCGCTTTCAAGCAGGTTGGAT
>probe:Drosophila_2:1632077_at:153:589; Interrogation_Position=3445; Antisense; TGGATTTCTTTCAACAACCCTGGAC
>probe:Drosophila_2:1632077_at:526:155; Interrogation_Position=3468; Antisense; ACAGAGCTCCTGATGCACGACAGAT
>probe:Drosophila_2:1632077_at:375:105; Interrogation_Position=3519; Antisense; AGACTTCTGCTCTCAATGCTGCTGA
>probe:Drosophila_2:1632077_at:568:513; Interrogation_Position=3615; Antisense; GTGATCGATTTTGTGCGAACCTATC
>probe:Drosophila_2:1632077_at:256:459; Interrogation_Position=3645; Antisense; GATTTCACTCACGAATTTGCGCTGC

Paste this into a BLAST search page for me
GCGATACTCCAAGCCGTACATGTTTACATGTTTACGGGAATCCTGCCAATAAAGCCCCTGCTTATAGGACAACTAATTTTCTGAGACCTTGACTACCTACGACTACCTACGATGATGGCGACTTTGACTTTTGCCGCATTCGACTTAACATAGAGATTGTCTGCGTCACCAAGAAATGCTACTCAATGATCTGCGCGGTCGCGGTCGCTTTCAAGCAGGTTGGATTGGATTTCTTTCAACAACCCTGGACACAGAGCTCCTGATGCACGACAGATAGACTTCTGCTCTCAATGCTGCTGAGTGATCGATTTTGTGCGAACCTATCGATTTCACTCACGAATTTGCGCTGC

Full Affymetrix probeset data:

Annotations for 1632077_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720