FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632078_at:

>probe:Drosophila_2:1632078_at:358:145; Interrogation_Position=1066; Antisense; ACTAGCAAATCCGTGGTTCTGGCCC
>probe:Drosophila_2:1632078_at:448:301; Interrogation_Position=1089; Antisense; CCCATCACATCTCCTACTATAAGTT
>probe:Drosophila_2:1632078_at:627:561; Interrogation_Position=1252; Antisense; GGAACTTAAGCGTCTAATGAACTAT
>probe:Drosophila_2:1632078_at:406:527; Interrogation_Position=703; Antisense; GGGTCTTTTGGCTATGGCCTGGATT
>probe:Drosophila_2:1632078_at:591:575; Interrogation_Position=718; Antisense; GGCCTGGATTGGAGCCATCATTAAC
>probe:Drosophila_2:1632078_at:709:37; Interrogation_Position=744; Antisense; ATCTACTGCTTATGTACTTGGCCAC
>probe:Drosophila_2:1632078_at:136:669; Interrogation_Position=771; Antisense; TACTCATCCTCATGTGGCCAGGACT
>probe:Drosophila_2:1632078_at:617:557; Interrogation_Position=805; Antisense; GGACATTTTTAAGGCCATCACCCAA
>probe:Drosophila_2:1632078_at:648:259; Interrogation_Position=823; Antisense; CACCCAAAGGGCCTCGAAGATTATT
>probe:Drosophila_2:1632078_at:492:659; Interrogation_Position=847; Antisense; TAACGAGAAGATCCAGTGCGGCAAA
>probe:Drosophila_2:1632078_at:294:455; Interrogation_Position=900; Antisense; GATAAACTCATCACCATTTGACCAA
>probe:Drosophila_2:1632078_at:86:153; Interrogation_Position=934; Antisense; ACATGCCTAAGTCATCTACTTGCCA
>probe:Drosophila_2:1632078_at:530:667; Interrogation_Position=950; Antisense; TACTTGCCATTATGCACACATCGCA
>probe:Drosophila_2:1632078_at:198:259; Interrogation_Position=966; Antisense; CACATCGCATCACTAAATCACACAT

Paste this into a BLAST search page for me
ACTAGCAAATCCGTGGTTCTGGCCCCCCATCACATCTCCTACTATAAGTTGGAACTTAAGCGTCTAATGAACTATGGGTCTTTTGGCTATGGCCTGGATTGGCCTGGATTGGAGCCATCATTAACATCTACTGCTTATGTACTTGGCCACTACTCATCCTCATGTGGCCAGGACTGGACATTTTTAAGGCCATCACCCAACACCCAAAGGGCCTCGAAGATTATTTAACGAGAAGATCCAGTGCGGCAAAGATAAACTCATCACCATTTGACCAAACATGCCTAAGTCATCTACTTGCCATACTTGCCATTATGCACACATCGCACACATCGCATCACTAAATCACACAT

Full Affymetrix probeset data:

Annotations for 1632078_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720