Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632080_s_at:

>probe:Drosophila_2:1632080_s_at:178:563; Interrogation_Position=106; Antisense; GGAAGCTGGTGCCTACATCACCAAG
>probe:Drosophila_2:1632080_s_at:366:207; Interrogation_Position=108; Antisense; AAGCTGGTGCCTACATCACCAAGAT
>probe:Drosophila_2:1632080_s_at:322:671; Interrogation_Position=173; Antisense; TACGAGACCAGCAACGGCATCGCCG
>probe:Drosophila_2:1632080_s_at:597:623; Interrogation_Position=192; Antisense; TCGCCGCCCAGGAGTCCGGAATTGG
>probe:Drosophila_2:1632080_s_at:274:559; Interrogation_Position=218; Antisense; GGAAACCACGCCAACGGAGGCTTCT
>probe:Drosophila_2:1632080_s_at:682:185; Interrogation_Position=230; Antisense; AACGGAGGCTTCTCGTGGTACTCGC
>probe:Drosophila_2:1632080_s_at:99:435; Interrogation_Position=257; Antisense; GAGGGTGAGCTCGTCCAGATCTCGT
>probe:Drosophila_2:1632080_s_at:429:419; Interrogation_Position=263; Antisense; GAGCTCGTCCAGATCTCGTACGTGG
>probe:Drosophila_2:1632080_s_at:58:275; Interrogation_Position=266; Antisense; CTCGTCCAGATCTCGTACGTGGCCG
>probe:Drosophila_2:1632080_s_at:181:263; Interrogation_Position=345; Antisense; CAGCTGCCATCCTTAGGAGCTTGGA
>probe:Drosophila_2:1632080_s_at:509:309; Interrogation_Position=350; Antisense; GCCATCCTTAGGAGCTTGGAGTACA
>probe:Drosophila_2:1632080_s_at:698:627; Interrogation_Position=354; Antisense; TCCTTAGGAGCTTGGAGTACATCCG
>probe:Drosophila_2:1632080_s_at:156:633; Interrogation_Position=396; Antisense; TCGAGCAGGAGTACCGCAGGCCCGC
>probe:Drosophila_2:1632080_s_at:424:299; Interrogation_Position=91; Antisense; CGCCACCTACAACCAGGAAGCTGGT

Paste this into a BLAST search page for me
GGAAGCTGGTGCCTACATCACCAAGAAGCTGGTGCCTACATCACCAAGATTACGAGACCAGCAACGGCATCGCCGTCGCCGCCCAGGAGTCCGGAATTGGGGAAACCACGCCAACGGAGGCTTCTAACGGAGGCTTCTCGTGGTACTCGCGAGGGTGAGCTCGTCCAGATCTCGTGAGCTCGTCCAGATCTCGTACGTGGCTCGTCCAGATCTCGTACGTGGCCGCAGCTGCCATCCTTAGGAGCTTGGAGCCATCCTTAGGAGCTTGGAGTACATCCTTAGGAGCTTGGAGTACATCCGTCGAGCAGGAGTACCGCAGGCCCGCCGCCACCTACAACCAGGAAGCTGGT

Full Affymetrix probeset data:

Annotations for 1632080_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime