FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632081_s_at:

>probe:Drosophila_2:1632081_s_at:666:101; Interrogation_Position=17; Antisense; AGAGCTACGCGGACGCACTGAGTGC
>probe:Drosophila_2:1632081_s_at:24:341; Interrogation_Position=20; Antisense; GCTACGCGGACGCACTGAGTGCCAA
>probe:Drosophila_2:1632081_s_at:419:409; Interrogation_Position=28; Antisense; GACGCACTGAGTGCCAAGGGCTATC
>probe:Drosophila_2:1632081_s_at:568:141; Interrogation_Position=33; Antisense; ACTGAGTGCCAAGGGCTATCGCAGC
>probe:Drosophila_2:1632081_s_at:39:87; Interrogation_Position=37; Antisense; AGTGCCAAGGGCTATCGCAGCTTCG
>probe:Drosophila_2:1632081_s_at:555:311; Interrogation_Position=40; Antisense; GCCAAGGGCTATCGCAGCTTCGGAT
>probe:Drosophila_2:1632081_s_at:167:223; Interrogation_Position=43; Antisense; AAGGGCTATCGCAGCTTCGGATTCG
>probe:Drosophila_2:1632081_s_at:296:571; Interrogation_Position=46; Antisense; GGCTATCGCAGCTTCGGATTCGATA
>probe:Drosophila_2:1632081_s_at:273:351; Interrogation_Position=53; Antisense; GCAGCTTCGGATTCGATACGGACAT
>probe:Drosophila_2:1632081_s_at:357:717; Interrogation_Position=58; Antisense; TTCGGATTCGATACGGACATGGAGA
>probe:Drosophila_2:1632081_s_at:27:637; Interrogation_Position=65; Antisense; TCGATACGGACATGGAGATGGACAT
>probe:Drosophila_2:1632081_s_at:89:587; Interrogation_Position=89; Antisense; TGGACATGGGCTGCACTACGATGCG
>probe:Drosophila_2:1632081_s_at:4:65; Interrogation_Position=94; Antisense; ATGGGCTGCACTACGATGCGGCGCA
>probe:Drosophila_2:1632081_s_at:709:333; Interrogation_Position=98; Antisense; GCTGCACTACGATGCGGCGCATCGA

Paste this into a BLAST search page for me
AGAGCTACGCGGACGCACTGAGTGCGCTACGCGGACGCACTGAGTGCCAAGACGCACTGAGTGCCAAGGGCTATCACTGAGTGCCAAGGGCTATCGCAGCAGTGCCAAGGGCTATCGCAGCTTCGGCCAAGGGCTATCGCAGCTTCGGATAAGGGCTATCGCAGCTTCGGATTCGGGCTATCGCAGCTTCGGATTCGATAGCAGCTTCGGATTCGATACGGACATTTCGGATTCGATACGGACATGGAGATCGATACGGACATGGAGATGGACATTGGACATGGGCTGCACTACGATGCGATGGGCTGCACTACGATGCGGCGCAGCTGCACTACGATGCGGCGCATCGA

Full Affymetrix probeset data:

Annotations for 1632081_s_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720