FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632082_at:

>probe:Drosophila_2:1632082_at:223:109; Interrogation_Position=4009; Antisense; AGAATTCCGGAGAGGTGTGCTACGC
>probe:Drosophila_2:1632082_at:399:597; Interrogation_Position=4024; Antisense; TGTGCTACGCGGATGCGGGAACCAA
>probe:Drosophila_2:1632082_at:180:533; Interrogation_Position=4052; Antisense; GGTGGAGTGCATCGAACCGCAAAAC
>probe:Drosophila_2:1632082_at:47:383; Interrogation_Position=4101; Antisense; GAACTGTCTTATCCCTTCGGCATTA
>probe:Drosophila_2:1632082_at:511:711; Interrogation_Position=4128; Antisense; TTCACGCACGATCAGTTCTACTGGA
>probe:Drosophila_2:1632082_at:92:725; Interrogation_Position=4183; Antisense; TTGACAGCTTGGGTGCACGGCAGAC
>probe:Drosophila_2:1632082_at:348:691; Interrogation_Position=4227; Antisense; TTTGGCAGCCACAAAATGTACGGCA
>probe:Drosophila_2:1632082_at:236:57; Interrogation_Position=4251; Antisense; ATGACCGTGGTGGAGCAGCACTGCC
>probe:Drosophila_2:1632082_at:300:101; Interrogation_Position=4285; Antisense; AGAGTCCCTGCCAGATCAGCAACGG
>probe:Drosophila_2:1632082_at:409:649; Interrogation_Position=4300; Antisense; TCAGCAACGGCGGATGCACGGACTC
>probe:Drosophila_2:1632082_at:727:629; Interrogation_Position=4352; Antisense; TCCGTCCGGAAAGAGCTGCAAGTGC
>probe:Drosophila_2:1632082_at:179:323; Interrogation_Position=4407; Antisense; GCGCCTGGCTACTAAGTCTATTTTA
>probe:Drosophila_2:1632082_at:550:189; Interrogation_Position=4529; Antisense; AACTTAACTAACTAGGAGTGCCTGT
>probe:Drosophila_2:1632082_at:46:433; Interrogation_Position=4544; Antisense; GAGTGCCTGTGTGCCATTTCAAAGA

Paste this into a BLAST search page for me
AGAATTCCGGAGAGGTGTGCTACGCTGTGCTACGCGGATGCGGGAACCAAGGTGGAGTGCATCGAACCGCAAAACGAACTGTCTTATCCCTTCGGCATTATTCACGCACGATCAGTTCTACTGGATTGACAGCTTGGGTGCACGGCAGACTTTGGCAGCCACAAAATGTACGGCAATGACCGTGGTGGAGCAGCACTGCCAGAGTCCCTGCCAGATCAGCAACGGTCAGCAACGGCGGATGCACGGACTCTCCGTCCGGAAAGAGCTGCAAGTGCGCGCCTGGCTACTAAGTCTATTTTAAACTTAACTAACTAGGAGTGCCTGTGAGTGCCTGTGTGCCATTTCAAAGA

Full Affymetrix probeset data:

Annotations for 1632082_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720