Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632083_at:

>probe:Drosophila_2:1632083_at:667:35; Interrogation_Position=181; Antisense; ATCATCTACATTGTGCCGGTTGGGA
>probe:Drosophila_2:1632083_at:17:25; Interrogation_Position=208; Antisense; ATATGTTTGGTGATCGTGGCGTTTC
>probe:Drosophila_2:1632083_at:634:139; Interrogation_Position=238; Antisense; ACGGGCTATCGTCTCAATGACTTTG
>probe:Drosophila_2:1632083_at:548:403; Interrogation_Position=256; Antisense; GACTTTGTACTTTTCTCCTATATGA
>probe:Drosophila_2:1632083_at:57:27; Interrogation_Position=286; Antisense; ATAGAGCAACAAGCCCGTTCGTACA
>probe:Drosophila_2:1632083_at:288:639; Interrogation_Position=304; Antisense; TCGTACACTCCGGAATCTTGGGATA
>probe:Drosophila_2:1632083_at:725:155; Interrogation_Position=419; Antisense; ACACTCGGCGCCAGTTTGAGATCGA
>probe:Drosophila_2:1632083_at:660:719; Interrogation_Position=510; Antisense; TTCCACATTGGATTCGAGCTGCGTA
>probe:Drosophila_2:1632083_at:255:289; Interrogation_Position=547; Antisense; CGGCGCATTCAGGAGCCAATCAAAT
>probe:Drosophila_2:1632083_at:435:651; Interrogation_Position=566; Antisense; TCAAATATCTCGTTAATGCCGCCGC
>probe:Drosophila_2:1632083_at:3:321; Interrogation_Position=583; Antisense; GCCGCCGCCTTGGACAATGTTAATG
>probe:Drosophila_2:1632083_at:500:337; Interrogation_Position=640; Antisense; GCTCGCTTGATTGCCCAGAATTGAA
>probe:Drosophila_2:1632083_at:643:723; Interrogation_Position=660; Antisense; TTGAATTCAACATTTGTCCGCCGTG
>probe:Drosophila_2:1632083_at:69:667; Interrogation_Position=694; Antisense; TACACTGCTCAATTACCAGGCCGAT

Paste this into a BLAST search page for me
ATCATCTACATTGTGCCGGTTGGGAATATGTTTGGTGATCGTGGCGTTTCACGGGCTATCGTCTCAATGACTTTGGACTTTGTACTTTTCTCCTATATGAATAGAGCAACAAGCCCGTTCGTACATCGTACACTCCGGAATCTTGGGATAACACTCGGCGCCAGTTTGAGATCGATTCCACATTGGATTCGAGCTGCGTACGGCGCATTCAGGAGCCAATCAAATTCAAATATCTCGTTAATGCCGCCGCGCCGCCGCCTTGGACAATGTTAATGGCTCGCTTGATTGCCCAGAATTGAATTGAATTCAACATTTGTCCGCCGTGTACACTGCTCAATTACCAGGCCGAT

Full Affymetrix probeset data:

Annotations for 1632083_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime