Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632085_at:

>probe:Drosophila_2:1632085_at:580:695; Interrogation_Position=113; Antisense; TTTCTATTCACCATGGGCGAGGCAT
>probe:Drosophila_2:1632085_at:90:273; Interrogation_Position=135; Antisense; CATATCTGAAGAGTGTCCGCGTGGA
>probe:Drosophila_2:1632085_at:416:443; Interrogation_Position=158; Antisense; GATGAGATTCCCTTTGCCGGAAGAA
>probe:Drosophila_2:1632085_at:448:235; Interrogation_Position=194; Antisense; AATCGGCGGTCCAGCGGTATTCATC
>probe:Drosophila_2:1632085_at:277:689; Interrogation_Position=211; Antisense; TATTCATCTCATCTCCAGTCTGGAG
>probe:Drosophila_2:1632085_at:416:553; Interrogation_Position=232; Antisense; GGAGCATCAGCGCACTTTTCTTCAT
>probe:Drosophila_2:1632085_at:205:61; Interrogation_Position=264; Antisense; ATGTGCCCTACATCATATGCTTTTA
>probe:Drosophila_2:1632085_at:94:69; Interrogation_Position=304; Antisense; ATGGCCATATGTGCCTGGATTCATG
>probe:Drosophila_2:1632085_at:645:671; Interrogation_Position=332; Antisense; TACCGGGTTGACAATGCAGCTCGCA
>probe:Drosophila_2:1632085_at:298:353; Interrogation_Position=347; Antisense; GCAGCTCGCAGTTTCTTCAATCAGA
>probe:Drosophila_2:1632085_at:572:617; Interrogation_Position=422; Antisense; TGCTTTCGTCCCTTATTCGACAAAT
>probe:Drosophila_2:1632085_at:470:161; Interrogation_Position=515; Antisense; AAATTGTTGCTCTCAACGGAGCCAC
>probe:Drosophila_2:1632085_at:399:487; Interrogation_Position=542; Antisense; GTACCGGTCGTCTACTTCGACAAGA
>probe:Drosophila_2:1632085_at:83:429; Interrogation_Position=611; Antisense; GAGTTTCTTGAGAGTTTCCTGCCAC

Paste this into a BLAST search page for me
TTTCTATTCACCATGGGCGAGGCATCATATCTGAAGAGTGTCCGCGTGGAGATGAGATTCCCTTTGCCGGAAGAAAATCGGCGGTCCAGCGGTATTCATCTATTCATCTCATCTCCAGTCTGGAGGGAGCATCAGCGCACTTTTCTTCATATGTGCCCTACATCATATGCTTTTAATGGCCATATGTGCCTGGATTCATGTACCGGGTTGACAATGCAGCTCGCAGCAGCTCGCAGTTTCTTCAATCAGATGCTTTCGTCCCTTATTCGACAAATAAATTGTTGCTCTCAACGGAGCCACGTACCGGTCGTCTACTTCGACAAGAGAGTTTCTTGAGAGTTTCCTGCCAC

Full Affymetrix probeset data:

Annotations for 1632085_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime