FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632086_at:

>probe:Drosophila_2:1632086_at:467:533; Interrogation_Position=2760; Antisense; GGTGCTGGAGCAACTCGATCAGGCT
>probe:Drosophila_2:1632086_at:640:295; Interrogation_Position=2828; Antisense; CGCAGGGACGCCATCAGGTGGTCAA
>probe:Drosophila_2:1632086_at:455:533; Interrogation_Position=2853; Antisense; GGTGGTCACACAGAATGCGCACAGT
>probe:Drosophila_2:1632086_at:11:291; Interrogation_Position=2882; Antisense; CGGAGAGTCATGTGCAGACCGTTAA
>probe:Drosophila_2:1632086_at:455:97; Interrogation_Position=2906; Antisense; AGATCTACGACGATGTGCAGCAGCC
>probe:Drosophila_2:1632086_at:165:63; Interrogation_Position=2918; Antisense; ATGTGCAGCAGCCATTGCGATTGCT
>probe:Drosophila_2:1632086_at:101:103; Interrogation_Position=2960; Antisense; AGAGCAATGCGTACTTGCCACCGGC
>probe:Drosophila_2:1632086_at:85:249; Interrogation_Position=3000; Antisense; AATTGTGCGGCAGGCGTCGAAGCCA
>probe:Drosophila_2:1632086_at:514:45; Interrogation_Position=3035; Antisense; ATCCCGTGGCCAGTCTGTAGAGGAT
>probe:Drosophila_2:1632086_at:457:435; Interrogation_Position=3054; Antisense; GAGGATTGGATTCCCAGCACTGATT
>probe:Drosophila_2:1632086_at:159:243; Interrogation_Position=3086; Antisense; AATATCTATCTCATCATCCAGCGTC
>probe:Drosophila_2:1632086_at:44:293; Interrogation_Position=3107; Antisense; CGTCTGCACTGCACTGCTATATATT
>probe:Drosophila_2:1632086_at:153:481; Interrogation_Position=3177; Antisense; GTTTGCGTTCCAATTCTGTTGTCAA
>probe:Drosophila_2:1632086_at:447:231; Interrogation_Position=3200; Antisense; AATGTTTCCAACTCATTTCGCATGA

Paste this into a BLAST search page for me
GGTGCTGGAGCAACTCGATCAGGCTCGCAGGGACGCCATCAGGTGGTCAAGGTGGTCACACAGAATGCGCACAGTCGGAGAGTCATGTGCAGACCGTTAAAGATCTACGACGATGTGCAGCAGCCATGTGCAGCAGCCATTGCGATTGCTAGAGCAATGCGTACTTGCCACCGGCAATTGTGCGGCAGGCGTCGAAGCCAATCCCGTGGCCAGTCTGTAGAGGATGAGGATTGGATTCCCAGCACTGATTAATATCTATCTCATCATCCAGCGTCCGTCTGCACTGCACTGCTATATATTGTTTGCGTTCCAATTCTGTTGTCAAAATGTTTCCAACTCATTTCGCATGA

Full Affymetrix probeset data:

Annotations for 1632086_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720