FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632087_at:

>probe:Drosophila_2:1632087_at:133:291; Interrogation_Position=103; Antisense; CGGTGCATCGGGTATATTTCAGAAT
>probe:Drosophila_2:1632087_at:12:697; Interrogation_Position=119; Antisense; TTTCAGAATATAAACCTCGGTGGCG
>probe:Drosophila_2:1632087_at:237:13; Interrogation_Position=13; Antisense; ATTCAGTCAACTGTAGCCAGAGCTA
>probe:Drosophila_2:1632087_at:282:137; Interrogation_Position=157; Antisense; ACGATCTTCAGGTGGCAACTTGGAC
>probe:Drosophila_2:1632087_at:95:555; Interrogation_Position=183; Antisense; GGAGCGATAGTGTTCACAGTTCTGA
>probe:Drosophila_2:1632087_at:432:93; Interrogation_Position=200; Antisense; AGTTCTGATGACGATAGGACTCTGA
>probe:Drosophila_2:1632087_at:481:557; Interrogation_Position=216; Antisense; GGACTCTGAAGCTACTGGAATCGTT
>probe:Drosophila_2:1632087_at:563:197; Interrogation_Position=275; Antisense; AACGATGCGGTGAGGAATTCTGGAT
>probe:Drosophila_2:1632087_at:478:463; Interrogation_Position=297; Antisense; GATTCGATACCGATAGATCCGCAGG
>probe:Drosophila_2:1632087_at:374:405; Interrogation_Position=323; Antisense; GACTCAAAGGAAGACGCTCGCGGAT
>probe:Drosophila_2:1632087_at:641:281; Interrogation_Position=339; Antisense; CTCGCGGATTCCAGTTTATACACAT
>probe:Drosophila_2:1632087_at:548:183; Interrogation_Position=47; Antisense; AAAATGCAATCCATTCTCCGACTGC
>probe:Drosophila_2:1632087_at:72:297; Interrogation_Position=65; Antisense; CGACTGCTGGTGCTGTTTGGATTAA
>probe:Drosophila_2:1632087_at:264:585; Interrogation_Position=82; Antisense; TGGATTAATCTATACCGCGATCGGT

Paste this into a BLAST search page for me
CGGTGCATCGGGTATATTTCAGAATTTTCAGAATATAAACCTCGGTGGCGATTCAGTCAACTGTAGCCAGAGCTAACGATCTTCAGGTGGCAACTTGGACGGAGCGATAGTGTTCACAGTTCTGAAGTTCTGATGACGATAGGACTCTGAGGACTCTGAAGCTACTGGAATCGTTAACGATGCGGTGAGGAATTCTGGATGATTCGATACCGATAGATCCGCAGGGACTCAAAGGAAGACGCTCGCGGATCTCGCGGATTCCAGTTTATACACATAAAATGCAATCCATTCTCCGACTGCCGACTGCTGGTGCTGTTTGGATTAATGGATTAATCTATACCGCGATCGGT

Full Affymetrix probeset data:

Annotations for 1632087_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720