FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632089_at:

>probe:Drosophila_2:1632089_at:207:97; Interrogation_Position=328; Antisense; AGATGTTCCCCGAGAAGCTGTCCAT
>probe:Drosophila_2:1632089_at:537:509; Interrogation_Position=433; Antisense; GTGCATACCAGAACATTGCCTGCTT
>probe:Drosophila_2:1632089_at:499:135; Interrogation_Position=458; Antisense; ACGCACCAACGCCATGAAGTATCTG
>probe:Drosophila_2:1632089_at:349:685; Interrogation_Position=477; Antisense; TATCTGCCCAACTACTTCGTAAAGG
>probe:Drosophila_2:1632089_at:381:109; Interrogation_Position=511; Antisense; AGAAGATGTTCTTCCTCTACCCGGA
>probe:Drosophila_2:1632089_at:428:697; Interrogation_Position=542; Antisense; TTTCAAGCGCGCCAAGCACAAGTGG
>probe:Drosophila_2:1632089_at:385:575; Interrogation_Position=565; Antisense; GGCGTATTATCAACCAGGCTCTACT
>probe:Drosophila_2:1632089_at:612:643; Interrogation_Position=584; Antisense; TCTACTCTCCGAATATGCCTATATC
>probe:Drosophila_2:1632089_at:551:531; Interrogation_Position=620; Antisense; GGGTCTGTTGTACACCATGACGGAC
>probe:Drosophila_2:1632089_at:66:55; Interrogation_Position=636; Antisense; ATGACGGACGTTGAGGACTTGCACA
>probe:Drosophila_2:1632089_at:479:333; Interrogation_Position=692; Antisense; GCTGTACGAGCGTCTTACCGAAGAG
>probe:Drosophila_2:1632089_at:223:101; Interrogation_Position=713; Antisense; AGAGGAGGCCAATGCTGATCCCATC
>probe:Drosophila_2:1632089_at:252:161; Interrogation_Position=787; Antisense; ACAAGGGCGATCATTTTCTGGCCAT
>probe:Drosophila_2:1632089_at:179:577; Interrogation_Position=817; Antisense; GGCGCCTTTAGGACACGTATATTCT

Paste this into a BLAST search page for me
AGATGTTCCCCGAGAAGCTGTCCATGTGCATACCAGAACATTGCCTGCTTACGCACCAACGCCATGAAGTATCTGTATCTGCCCAACTACTTCGTAAAGGAGAAGATGTTCTTCCTCTACCCGGATTTCAAGCGCGCCAAGCACAAGTGGGGCGTATTATCAACCAGGCTCTACTTCTACTCTCCGAATATGCCTATATCGGGTCTGTTGTACACCATGACGGACATGACGGACGTTGAGGACTTGCACAGCTGTACGAGCGTCTTACCGAAGAGAGAGGAGGCCAATGCTGATCCCATCACAAGGGCGATCATTTTCTGGCCATGGCGCCTTTAGGACACGTATATTCT

Full Affymetrix probeset data:

Annotations for 1632089_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720