FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632090_at:

>probe:Drosophila_2:1632090_at:178:467; Interrogation_Position=1087; Antisense; GGGCTGCCAAGAGCTCGTTCGGCCA
>probe:Drosophila_2:1632090_at:654:205; Interrogation_Position=1117; Antisense; AAGCGCAGTCGTTCGTGTCTCCGGA
>probe:Drosophila_2:1632090_at:151:515; Interrogation_Position=1131; Antisense; GTGTCTCCGGAACAAGGATCTCTGG
>probe:Drosophila_2:1632090_at:294:39; Interrogation_Position=1148; Antisense; ATCTCTGGGACAGTGGCGGATCCGT
>probe:Drosophila_2:1632090_at:282:391; Interrogation_Position=1238; Antisense; GAAACTGCTGGCATTGTCCGCGCTG
>probe:Drosophila_2:1632090_at:449:583; Interrogation_Position=1282; Antisense; TGGCATCCCGGCTTGGTGCGAGCTC
>probe:Drosophila_2:1632090_at:330:417; Interrogation_Position=1301; Antisense; GAGCTCCTCCAAGAGATGGTCGCTA
>probe:Drosophila_2:1632090_at:378:659; Interrogation_Position=1337; Antisense; TAAGAGCCACTCCTACACTGTAAAA
>probe:Drosophila_2:1632090_at:232:249; Interrogation_Position=820; Antisense; CAATTGGTGCAGTACGACCTGTCCT
>probe:Drosophila_2:1632090_at:671:315; Interrogation_Position=851; Antisense; GCCTGCTGGCCGAATTGCGCAAGGA
>probe:Drosophila_2:1632090_at:388:435; Interrogation_Position=882; Antisense; GAGGTCCTGTTGTGACCTGCAGATC
>probe:Drosophila_2:1632090_at:183:51; Interrogation_Position=932; Antisense; ATGCGCCCACGGTTAGGTTTCTAGA
>probe:Drosophila_2:1632090_at:20:541; Interrogation_Position=947; Antisense; GGTTTCTAGATCAGCCAGATTCCAG
>probe:Drosophila_2:1632090_at:470:375; Interrogation_Position=978; Antisense; GAAGAGAGAGCCTCATTGCCCGCCG

Paste this into a BLAST search page for me
GGGCTGCCAAGAGCTCGTTCGGCCAAAGCGCAGTCGTTCGTGTCTCCGGAGTGTCTCCGGAACAAGGATCTCTGGATCTCTGGGACAGTGGCGGATCCGTGAAACTGCTGGCATTGTCCGCGCTGTGGCATCCCGGCTTGGTGCGAGCTCGAGCTCCTCCAAGAGATGGTCGCTATAAGAGCCACTCCTACACTGTAAAACAATTGGTGCAGTACGACCTGTCCTGCCTGCTGGCCGAATTGCGCAAGGAGAGGTCCTGTTGTGACCTGCAGATCATGCGCCCACGGTTAGGTTTCTAGAGGTTTCTAGATCAGCCAGATTCCAGGAAGAGAGAGCCTCATTGCCCGCCG

Full Affymetrix probeset data:

Annotations for 1632090_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720