FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632091_at:

>probe:Drosophila_2:1632091_at:577:221; Interrogation_Position=1176; Antisense; AAGTGGTGACGCAGATCCGCCATCA
>probe:Drosophila_2:1632091_at:257:563; Interrogation_Position=1233; Antisense; GGAAGCCACAGCCAGTGACCACAGT
>probe:Drosophila_2:1632091_at:521:93; Interrogation_Position=1266; Antisense; AGTTGCAGTTGCATCAGCTGCACCA
>probe:Drosophila_2:1632091_at:471:617; Interrogation_Position=1305; Antisense; TGCACCAGCAAAGGCCACAGACGTT
>probe:Drosophila_2:1632091_at:55:123; Interrogation_Position=1452; Antisense; AGCGTCGGCCGCAGGTGTTCATTGC
>probe:Drosophila_2:1632091_at:144:645; Interrogation_Position=1470; Antisense; TCATTGCCACAACGCCGAGGTATTA
>probe:Drosophila_2:1632091_at:716:327; Interrogation_Position=1549; Antisense; GCAGTAAACAGTCTTGTCGTTCCCT
>probe:Drosophila_2:1632091_at:330:639; Interrogation_Position=1573; Antisense; TCGGATCCACCTCTCGTGTATATTC
>probe:Drosophila_2:1632091_at:89:481; Interrogation_Position=1590; Antisense; GTATATTCCCCGTCTAAGTAGCTTT
>probe:Drosophila_2:1632091_at:186:659; Interrogation_Position=1604; Antisense; TAAGTAGCTTTAAGCTCTCGCCCCA
>probe:Drosophila_2:1632091_at:520:165; Interrogation_Position=1647; Antisense; AAATCCTTGCGCGAGTTTTGTGTAC
>probe:Drosophila_2:1632091_at:530:59; Interrogation_Position=1688; Antisense; ATGTCCTGCTAGAAGAATCCGCCTT
>probe:Drosophila_2:1632091_at:385:631; Interrogation_Position=1705; Antisense; TCCGCCTTCTAACTCAATTCGTTAA
>probe:Drosophila_2:1632091_at:132:127; Interrogation_Position=1737; Antisense; AGCCACATTAAGTTAGCCGCTCACT

Paste this into a BLAST search page for me
AAGTGGTGACGCAGATCCGCCATCAGGAAGCCACAGCCAGTGACCACAGTAGTTGCAGTTGCATCAGCTGCACCATGCACCAGCAAAGGCCACAGACGTTAGCGTCGGCCGCAGGTGTTCATTGCTCATTGCCACAACGCCGAGGTATTAGCAGTAAACAGTCTTGTCGTTCCCTTCGGATCCACCTCTCGTGTATATTCGTATATTCCCCGTCTAAGTAGCTTTTAAGTAGCTTTAAGCTCTCGCCCCAAAATCCTTGCGCGAGTTTTGTGTACATGTCCTGCTAGAAGAATCCGCCTTTCCGCCTTCTAACTCAATTCGTTAAAGCCACATTAAGTTAGCCGCTCACT

Full Affymetrix probeset data:

Annotations for 1632091_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720