Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632094_at:

>probe:Drosophila_2:1632094_at:581:541; Interrogation_Position=1039; Antisense; GGATAGCCCCTTGTTTAATGTAATT
>probe:Drosophila_2:1632094_at:585:41; Interrogation_Position=513; Antisense; ATCGGGCTATGATCGCGGGCACATG
>probe:Drosophila_2:1632094_at:593:585; Interrogation_Position=546; Antisense; TGGAAATCACCGACTGCACCAGAAG
>probe:Drosophila_2:1632094_at:462:377; Interrogation_Position=567; Antisense; GAAGCACTGCGACGAAACCTTCTAC
>probe:Drosophila_2:1632094_at:613:201; Interrogation_Position=582; Antisense; AACCTTCTACCTATCGAACATGGCG
>probe:Drosophila_2:1632094_at:336:569; Interrogation_Position=622; Antisense; GGCTTCAACCGGGATGCCTGGAACA
>probe:Drosophila_2:1632094_at:283:415; Interrogation_Position=672; Antisense; GACCAAGACCTACTCCAATGTGTAC
>probe:Drosophila_2:1632094_at:51:229; Interrogation_Position=688; Antisense; AATGTGTACGTCTGTACGGGTCCAC
>probe:Drosophila_2:1632094_at:483:159; Interrogation_Position=803; Antisense; ACAAGGTTATTGTGGGCGAGTCCGC
>probe:Drosophila_2:1632094_at:440:543; Interrogation_Position=846; Antisense; GGAGTCGTACGTGATGCCCAATCAG
>probe:Drosophila_2:1632094_at:86:81; Interrogation_Position=869; Antisense; AGGTGATCAGCAACGACACTCCCAT
>probe:Drosophila_2:1632094_at:592:35; Interrogation_Position=892; Antisense; ATCAGTGTGTTTCAGGTGCCGCCAG
>probe:Drosophila_2:1632094_at:240:543; Interrogation_Position=937; Antisense; GGATTGCTCTTCTTCGATCAAATCA
>probe:Drosophila_2:1632094_at:120:115; Interrogation_Position=968; Antisense; AGCAGCTAACCACCATCAATGGCAA

Paste this into a BLAST search page for me
GGATAGCCCCTTGTTTAATGTAATTATCGGGCTATGATCGCGGGCACATGTGGAAATCACCGACTGCACCAGAAGGAAGCACTGCGACGAAACCTTCTACAACCTTCTACCTATCGAACATGGCGGGCTTCAACCGGGATGCCTGGAACAGACCAAGACCTACTCCAATGTGTACAATGTGTACGTCTGTACGGGTCCACACAAGGTTATTGTGGGCGAGTCCGCGGAGTCGTACGTGATGCCCAATCAGAGGTGATCAGCAACGACACTCCCATATCAGTGTGTTTCAGGTGCCGCCAGGGATTGCTCTTCTTCGATCAAATCAAGCAGCTAACCACCATCAATGGCAA

Full Affymetrix probeset data:

Annotations for 1632094_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime