FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632095_at:

>probe:Drosophila_2:1632095_at:300:355; Interrogation_Position=321; Antisense; GCACCTGTGGCATTTTTGCAAAATA
>probe:Drosophila_2:1632095_at:246:311; Interrogation_Position=347; Antisense; GCCAAAGGAATGTACCGCCAAGGTC
>probe:Drosophila_2:1632095_at:467:223; Interrogation_Position=366; Antisense; AAGGTCCTGGCACTGCAACATCTGT
>probe:Drosophila_2:1632095_at:573:199; Interrogation_Position=407; Antisense; AACGCGATCACCACTGCAATTTTGT
>probe:Drosophila_2:1632095_at:95:25; Interrogation_Position=469; Antisense; ATATGGTTCTCATTTTACGCGGCCA
>probe:Drosophila_2:1632095_at:137:675; Interrogation_Position=498; Antisense; TAGCGCAGTGGCCTTATTTGATAAC
>probe:Drosophila_2:1632095_at:368:269; Interrogation_Position=525; Antisense; CATGTTGGCCCATAAGCACGGTGTT
>probe:Drosophila_2:1632095_at:659:241; Interrogation_Position=636; Antisense; AATAGTCAGTGTCTTAGGTGTCAAC
>probe:Drosophila_2:1632095_at:146:81; Interrogation_Position=651; Antisense; AGGTGTCAACATATTCGCCGTTCTC
>probe:Drosophila_2:1632095_at:718:351; Interrogation_Position=682; Antisense; GCAGCACTGTTTTGCACCCAAGTAG
>probe:Drosophila_2:1632095_at:712:11; Interrogation_Position=740; Antisense; ATTCTGATCGAACCTATGACCTTGG
>probe:Drosophila_2:1632095_at:453:241; Interrogation_Position=775; Antisense; AATTTGACCCTGATCCTGGGAAGTC
>probe:Drosophila_2:1632095_at:667:459; Interrogation_Position=803; Antisense; GATTATGGACTTGCCTATCGCCAAA
>probe:Drosophila_2:1632095_at:277:441; Interrogation_Position=860; Antisense; GATGGAAATCGAAGCGTGCCGTCTA

Paste this into a BLAST search page for me
GCACCTGTGGCATTTTTGCAAAATAGCCAAAGGAATGTACCGCCAAGGTCAAGGTCCTGGCACTGCAACATCTGTAACGCGATCACCACTGCAATTTTGTATATGGTTCTCATTTTACGCGGCCATAGCGCAGTGGCCTTATTTGATAACCATGTTGGCCCATAAGCACGGTGTTAATAGTCAGTGTCTTAGGTGTCAACAGGTGTCAACATATTCGCCGTTCTCGCAGCACTGTTTTGCACCCAAGTAGATTCTGATCGAACCTATGACCTTGGAATTTGACCCTGATCCTGGGAAGTCGATTATGGACTTGCCTATCGCCAAAGATGGAAATCGAAGCGTGCCGTCTA

Full Affymetrix probeset data:

Annotations for 1632095_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720