FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632096_at:

>probe:Drosophila_2:1632096_at:254:517; Interrogation_Position=241; Antisense; GTGTGTCGACTAGAAGACCCTTCAA
>probe:Drosophila_2:1632096_at:126:33; Interrogation_Position=329; Antisense; ATAAGACCGTCGTCCATCTAAGCTG
>probe:Drosophila_2:1632096_at:554:211; Interrogation_Position=385; Antisense; AAGAACATTTGCGACCAGGACCAGT
>probe:Drosophila_2:1632096_at:416:71; Interrogation_Position=472; Antisense; AGGCAGTGCACCCTGAATGGTCGTC
>probe:Drosophila_2:1632096_at:55:65; Interrogation_Position=488; Antisense; ATGGTCGTCCGATAGACTGCGATCA
>probe:Drosophila_2:1632096_at:107:443; Interrogation_Position=525; Antisense; GATGGGCACTCTAATGTCGGTCACC
>probe:Drosophila_2:1632096_at:680:441; Interrogation_Position=580; Antisense; GATGGTCTGCAGTTTTGCGACGAAA
>probe:Drosophila_2:1632096_at:556:91; Interrogation_Position=632; Antisense; AGTTTACGGTTGTCTGCCATGCTAC
>probe:Drosophila_2:1632096_at:468:51; Interrogation_Position=650; Antisense; ATGCTACCATCGTGTCGCCGTATAT
>probe:Drosophila_2:1632096_at:173:481; Interrogation_Position=669; Antisense; GTATATTCTGGTCGCCACGGAGATC
>probe:Drosophila_2:1632096_at:604:451; Interrogation_Position=690; Antisense; GATCTGTTTCCGTAATGTGGCCATT
>probe:Drosophila_2:1632096_at:77:715; Interrogation_Position=742; Antisense; TTCTACACATACAACAGCTTCCTGG
>probe:Drosophila_2:1632096_at:79:381; Interrogation_Position=772; Antisense; GAACCCCATCCGTTTAAGTTGCACA
>probe:Drosophila_2:1632096_at:546:93; Interrogation_Position=788; Antisense; AGTTGCACAACGTGTCCCATATACA

Paste this into a BLAST search page for me
GTGTGTCGACTAGAAGACCCTTCAAATAAGACCGTCGTCCATCTAAGCTGAAGAACATTTGCGACCAGGACCAGTAGGCAGTGCACCCTGAATGGTCGTCATGGTCGTCCGATAGACTGCGATCAGATGGGCACTCTAATGTCGGTCACCGATGGTCTGCAGTTTTGCGACGAAAAGTTTACGGTTGTCTGCCATGCTACATGCTACCATCGTGTCGCCGTATATGTATATTCTGGTCGCCACGGAGATCGATCTGTTTCCGTAATGTGGCCATTTTCTACACATACAACAGCTTCCTGGGAACCCCATCCGTTTAAGTTGCACAAGTTGCACAACGTGTCCCATATACA

Full Affymetrix probeset data:

Annotations for 1632096_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720