FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632097_at:

>probe:Drosophila_2:1632097_at:498:307; Interrogation_Position=1049; Antisense; CCAGGTCCGGATCTGCAGTGCCCAG
>probe:Drosophila_2:1632097_at:313:39; Interrogation_Position=1059; Antisense; ATCTGCAGTGCCCAGCCAGCGGTTC
>probe:Drosophila_2:1632097_at:664:309; Interrogation_Position=1070; Antisense; CCAGCCAGCGGTTCGCCCAGAAGAG
>probe:Drosophila_2:1632097_at:195:541; Interrogation_Position=1079; Antisense; GGTTCGCCCAGAAGAGGCGCCACAT
>probe:Drosophila_2:1632097_at:25:215; Interrogation_Position=1090; Antisense; AAGAGGCGCCACATTAGCCCGGACA
>probe:Drosophila_2:1632097_at:331:71; Interrogation_Position=1093; Antisense; AGGCGCCACATTAGCCCGGACAGTG
>probe:Drosophila_2:1632097_at:450:83; Interrogation_Position=1114; Antisense; AGTGGGCACAACTCGACCAGCGATT
>probe:Drosophila_2:1632097_at:262:567; Interrogation_Position=1118; Antisense; GGCACAACTCGACCAGCGATTTTGA
>probe:Drosophila_2:1632097_at:244:145; Interrogation_Position=1124; Antisense; ACTCGACCAGCGATTTTGAGGAGGA
>probe:Drosophila_2:1632097_at:694:553; Interrogation_Position=1146; Antisense; GGAGCTGGTGGCCATGGGATCATGC
>probe:Drosophila_2:1632097_at:69:435; Interrogation_Position=1183; Antisense; GAGGCGGTTACCAAGCGGCGGCTGA
>probe:Drosophila_2:1632097_at:470:205; Interrogation_Position=1195; Antisense; AAGCGGCGGCTGAGCTTCTCCTACG
>probe:Drosophila_2:1632097_at:382:307; Interrogation_Position=1214; Antisense; CCTACGCCGAGGATCTGTTCGTGGA
>probe:Drosophila_2:1632097_at:311:135; Interrogation_Position=1217; Antisense; ACGCCGAGGATCTGTTCGTGGAGAA

Paste this into a BLAST search page for me
CCAGGTCCGGATCTGCAGTGCCCAGATCTGCAGTGCCCAGCCAGCGGTTCCCAGCCAGCGGTTCGCCCAGAAGAGGGTTCGCCCAGAAGAGGCGCCACATAAGAGGCGCCACATTAGCCCGGACAAGGCGCCACATTAGCCCGGACAGTGAGTGGGCACAACTCGACCAGCGATTGGCACAACTCGACCAGCGATTTTGAACTCGACCAGCGATTTTGAGGAGGAGGAGCTGGTGGCCATGGGATCATGCGAGGCGGTTACCAAGCGGCGGCTGAAAGCGGCGGCTGAGCTTCTCCTACGCCTACGCCGAGGATCTGTTCGTGGAACGCCGAGGATCTGTTCGTGGAGAA

Full Affymetrix probeset data:

Annotations for 1632097_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720