Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632098_at:

>probe:Drosophila_2:1632098_at:387:105; Interrogation_Position=1541; Antisense; AGACTGTGGACCAAGAGCTGCTCGA
>probe:Drosophila_2:1632098_at:445:213; Interrogation_Position=1553; Antisense; AAGAGCTGCTCGATGCGCAACTGCA
>probe:Drosophila_2:1632098_at:681:359; Interrogation_Position=1569; Antisense; GCAACTGCAGCTGGCCTATCAACAG
>probe:Drosophila_2:1632098_at:426:491; Interrogation_Position=1605; Antisense; GTACAAGAAGTACGGCGGTCCCGAT
>probe:Drosophila_2:1632098_at:18:289; Interrogation_Position=1617; Antisense; CGGCGGTCCCGATGGCGTCAACGAA
>probe:Drosophila_2:1632098_at:603:107; Interrogation_Position=1739; Antisense; AGAAGATGTCCGTGCAGTCGGGCAA
>probe:Drosophila_2:1632098_at:157:291; Interrogation_Position=1757; Antisense; CGGGCAAGGTGCACAAGGTCAACAA
>probe:Drosophila_2:1632098_at:530:79; Interrogation_Position=1802; Antisense; AGGTCGATGAGCACCGCCTGCAAGC
>probe:Drosophila_2:1632098_at:559:203; Interrogation_Position=1823; Antisense; AAGCGCGTATGGTGAAGCCCCGTCA
>probe:Drosophila_2:1632098_at:229:497; Interrogation_Position=1844; Antisense; GTCATCGCAATCTGTTCCGGAAACT
>probe:Drosophila_2:1632098_at:493:177; Interrogation_Position=1864; Antisense; AAACTCATCCGCGAGAAGCAGACTA
>probe:Drosophila_2:1632098_at:389:377; Interrogation_Position=1917; Antisense; GAAGCGACGAACCATCGAGGCCAAC
>probe:Drosophila_2:1632098_at:321:311; Interrogation_Position=2002; Antisense; GCCAAGGCTTCCAAGCTGGGCAAGT
>probe:Drosophila_2:1632098_at:225:529; Interrogation_Position=2047; Antisense; GGGATCTGTGTCTTGATTTAGGTTT

Paste this into a BLAST search page for me
AGACTGTGGACCAAGAGCTGCTCGAAAGAGCTGCTCGATGCGCAACTGCAGCAACTGCAGCTGGCCTATCAACAGGTACAAGAAGTACGGCGGTCCCGATCGGCGGTCCCGATGGCGTCAACGAAAGAAGATGTCCGTGCAGTCGGGCAACGGGCAAGGTGCACAAGGTCAACAAAGGTCGATGAGCACCGCCTGCAAGCAAGCGCGTATGGTGAAGCCCCGTCAGTCATCGCAATCTGTTCCGGAAACTAAACTCATCCGCGAGAAGCAGACTAGAAGCGACGAACCATCGAGGCCAACGCCAAGGCTTCCAAGCTGGGCAAGTGGGATCTGTGTCTTGATTTAGGTTT

Full Affymetrix probeset data:

Annotations for 1632098_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime