FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632103_at:

>probe:Drosophila_2:1632103_at:645:157; Interrogation_Position=479; Antisense; ACACTTCGCTGCAGGGCGGACGTAT
>probe:Drosophila_2:1632103_at:479:289; Interrogation_Position=495; Antisense; CGGACGTATGGGTCTGCGTGCTTAT
>probe:Drosophila_2:1632103_at:42:329; Interrogation_Position=510; Antisense; GCGTGCTTATGTCTGCATTCAACTA
>probe:Drosophila_2:1632103_at:491:13; Interrogation_Position=526; Antisense; ATTCAACTAGGAGTTCCCGGCGGCA
>probe:Drosophila_2:1632103_at:500:213; Interrogation_Position=550; Antisense; AAGAGCGGCTGCATGTTCACGCCCA
>probe:Drosophila_2:1632103_at:548:609; Interrogation_Position=587; Antisense; TGACCAGCTACGAGCCGGAGACATT
>probe:Drosophila_2:1632103_at:167:151; Interrogation_Position=607; Antisense; ACATTTGGGCTCAAGCTGCTTCAGA
>probe:Drosophila_2:1632103_at:84:713; Interrogation_Position=626; Antisense; TTCAGAAGACCGTAGGCGTTTCGCC
>probe:Drosophila_2:1632103_at:304:617; Interrogation_Position=719; Antisense; TGCAGTCCCTGCTGGATCTTATTCT
>probe:Drosophila_2:1632103_at:61:671; Interrogation_Position=748; Antisense; TACGTTGACGACGTGATCGCTCACA
>probe:Drosophila_2:1632103_at:212:57; Interrogation_Position=835; Antisense; ATGACCCACGAGCAGTTCACTCAGA
>probe:Drosophila_2:1632103_at:130:713; Interrogation_Position=850; Antisense; TTCACTCAGATGTTCAACGCCAACG
>probe:Drosophila_2:1632103_at:193:197; Interrogation_Position=871; Antisense; AACGTACGCAACCTTCTGCTGGTCA
>probe:Drosophila_2:1632103_at:292:183; Interrogation_Position=916; Antisense; AAAACCCAGCTGCAGCTTAACGAAA

Paste this into a BLAST search page for me
ACACTTCGCTGCAGGGCGGACGTATCGGACGTATGGGTCTGCGTGCTTATGCGTGCTTATGTCTGCATTCAACTAATTCAACTAGGAGTTCCCGGCGGCAAAGAGCGGCTGCATGTTCACGCCCATGACCAGCTACGAGCCGGAGACATTACATTTGGGCTCAAGCTGCTTCAGATTCAGAAGACCGTAGGCGTTTCGCCTGCAGTCCCTGCTGGATCTTATTCTTACGTTGACGACGTGATCGCTCACAATGACCCACGAGCAGTTCACTCAGATTCACTCAGATGTTCAACGCCAACGAACGTACGCAACCTTCTGCTGGTCAAAAACCCAGCTGCAGCTTAACGAAA

Full Affymetrix probeset data:

Annotations for 1632103_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720