Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632105_a_at:

>probe:Drosophila_2:1632105_a_at:114:443; Interrogation_Position=307; Antisense; GATGTGGCTGCCGAGAAGACCCAAC
>probe:Drosophila_2:1632105_a_at:643:199; Interrogation_Position=322; Antisense; AAGACCCAACAGTCGATCTTCGAGG
>probe:Drosophila_2:1632105_a_at:536:81; Interrogation_Position=344; Antisense; AGGGCATCACCGCTTTCAATCAGAA
>probe:Drosophila_2:1632105_a_at:172:423; Interrogation_Position=394; Antisense; GAGAAGAACCCGTTGCCCGATAAGG
>probe:Drosophila_2:1632105_a_at:471:109; Interrogation_Position=429; Antisense; AGAAGAATCAGTTCATCGCCGGCAT
>probe:Drosophila_2:1632105_a_at:440:269; Interrogation_Position=442; Antisense; CATCGCCGGCATCGAGAACTTTGAT
>probe:Drosophila_2:1632105_a_at:39:57; Interrogation_Position=495; Antisense; ATGAGAAGAACGTGCTGCCCACCAA
>probe:Drosophila_2:1632105_a_at:447:229; Interrogation_Position=563; Antisense; AATGTGGTCCACTCCGATCCGAGAT
>probe:Drosophila_2:1632105_a_at:601:303; Interrogation_Position=649; Antisense; CCGCATCTCACTCTTTATACGTATA
>probe:Drosophila_2:1632105_a_at:364:483; Interrogation_Position=669; Antisense; GTATAAAGCTATTCCCTCTCATTTT
>probe:Drosophila_2:1632105_a_at:15:281; Interrogation_Position=684; Antisense; CTCTCATTTTTCAACTGCTACCAAG
>probe:Drosophila_2:1632105_a_at:396:217; Interrogation_Position=706; Antisense; AAGTTATTCGAACCGCTGCGCATGC
>probe:Drosophila_2:1632105_a_at:263:689; Interrogation_Position=754; Antisense; TATTATCGTATTTCGGTTGTCCGTT
>probe:Drosophila_2:1632105_a_at:548:213; Interrogation_Position=837; Antisense; AAGAGAGCCAGTCTCATTCCTACAG

Paste this into a BLAST search page for me
GATGTGGCTGCCGAGAAGACCCAACAAGACCCAACAGTCGATCTTCGAGGAGGGCATCACCGCTTTCAATCAGAAGAGAAGAACCCGTTGCCCGATAAGGAGAAGAATCAGTTCATCGCCGGCATCATCGCCGGCATCGAGAACTTTGATATGAGAAGAACGTGCTGCCCACCAAAATGTGGTCCACTCCGATCCGAGATCCGCATCTCACTCTTTATACGTATAGTATAAAGCTATTCCCTCTCATTTTCTCTCATTTTTCAACTGCTACCAAGAAGTTATTCGAACCGCTGCGCATGCTATTATCGTATTTCGGTTGTCCGTTAAGAGAGCCAGTCTCATTCCTACAG

Full Affymetrix probeset data:

Annotations for 1632105_a_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime