FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632106_at:

>probe:Drosophila_2:1632106_at:52:591; Interrogation_Position=1592; Antisense; TGGTGGGTCACGTGCACTACGCCGA
>probe:Drosophila_2:1632106_at:598:435; Interrogation_Position=1615; Antisense; GAGGTTCCAGATCCCGAGCTCGAGT
>probe:Drosophila_2:1632106_at:78:431; Interrogation_Position=1636; Antisense; GAGTACGATGCCGAGTCCAGCAGCA
>probe:Drosophila_2:1632106_at:111:115; Interrogation_Position=1654; Antisense; AGCAGCACGGAGAGCGCCAAATTAG
>probe:Drosophila_2:1632106_at:593:287; Interrogation_Position=1724; Antisense; CGGCCAACTAGGGAGCTCGAGGATC
>probe:Drosophila_2:1632106_at:640:449; Interrogation_Position=1745; Antisense; GATCGGGATACTGGCGTCCAGGCAT
>probe:Drosophila_2:1632106_at:181:503; Interrogation_Position=1760; Antisense; GTCCAGGCATCCAGGTCGAGATCGA
>probe:Drosophila_2:1632106_at:555:223; Interrogation_Position=1810; Antisense; AAGGATCGTCACTTAATCTTGCGTC
>probe:Drosophila_2:1632106_at:332:37; Interrogation_Position=1825; Antisense; ATCTTGCGTCTGTCTATGCGAGGGC
>probe:Drosophila_2:1632106_at:188:37; Interrogation_Position=1903; Antisense; ATCTATATCTTCACACCAGACCAAC
>probe:Drosophila_2:1632106_at:267:187; Interrogation_Position=1925; Antisense; AACACACCTGCACCGCAATGGTTAA
>probe:Drosophila_2:1632106_at:638:301; Interrogation_Position=1986; Antisense; CCCTCATTTTCGTATCTTCATTTGT
>probe:Drosophila_2:1632106_at:349:291; Interrogation_Position=2018; Antisense; TAGGTATTTAGCACGGTACGACATA
>probe:Drosophila_2:1632106_at:535:163; Interrogation_Position=2086; Antisense; AAATATGCTCTCAGTCCGAGACAAA

Paste this into a BLAST search page for me
TGGTGGGTCACGTGCACTACGCCGAGAGGTTCCAGATCCCGAGCTCGAGTGAGTACGATGCCGAGTCCAGCAGCAAGCAGCACGGAGAGCGCCAAATTAGCGGCCAACTAGGGAGCTCGAGGATCGATCGGGATACTGGCGTCCAGGCATGTCCAGGCATCCAGGTCGAGATCGAAAGGATCGTCACTTAATCTTGCGTCATCTTGCGTCTGTCTATGCGAGGGCATCTATATCTTCACACCAGACCAACAACACACCTGCACCGCAATGGTTAACCCTCATTTTCGTATCTTCATTTGTTAGGTATTTAGCACGGTACGACATAAAATATGCTCTCAGTCCGAGACAAA

Full Affymetrix probeset data:

Annotations for 1632106_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720