FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632108_at:

>probe:Drosophila_2:1632108_at:420:621; Interrogation_Position=1728; Antisense; TGCGGCTTCCGGACTCTAATAAACG
>probe:Drosophila_2:1632108_at:448:463; Interrogation_Position=1814; Antisense; GATTCTCTTACGCATTTCAGTCGGA
>probe:Drosophila_2:1632108_at:491:11; Interrogation_Position=1850; Antisense; ATTCGATCCAGGTTCATCTACGTGA
>probe:Drosophila_2:1632108_at:218:315; Interrogation_Position=1990; Antisense; GCCATCCGACGGGACCGATTATAAT
>probe:Drosophila_2:1632108_at:71:175; Interrogation_Position=2032; Antisense; AAAGCCGTGGATCCAGCAGCTGCGT
>probe:Drosophila_2:1632108_at:473:389; Interrogation_Position=2059; Antisense; GAAAAACCCATATCAGTATCTCTTG
>probe:Drosophila_2:1632108_at:680:629; Interrogation_Position=2077; Antisense; TCTCTTGAAAAAACTGCGATCGCGG
>probe:Drosophila_2:1632108_at:723:325; Interrogation_Position=2092; Antisense; GCGATCGCGGAAATCTTACAGGGAT
>probe:Drosophila_2:1632108_at:580:529; Interrogation_Position=2112; Antisense; GGGATAGCCTCTACATGCAGACCTA
>probe:Drosophila_2:1632108_at:62:355; Interrogation_Position=2140; Antisense; GCACCTGTGTGACATGGCCGAGAAC
>probe:Drosophila_2:1632108_at:16:541; Interrogation_Position=2167; Antisense; GGTTTCTGTTATCGAGAGCACCAAA
>probe:Drosophila_2:1632108_at:286:177; Interrogation_Position=2213; Antisense; AAACAGCTTTTTGCGGCTTGTTTGC
>probe:Drosophila_2:1632108_at:652:339; Interrogation_Position=2228; Antisense; GCTTGTTTGCAATGTTAACGTCCAA
>probe:Drosophila_2:1632108_at:226:375; Interrogation_Position=2268; Antisense; GAAGTTGCTAAAACTCTCGCATTGA

Paste this into a BLAST search page for me
TGCGGCTTCCGGACTCTAATAAACGGATTCTCTTACGCATTTCAGTCGGAATTCGATCCAGGTTCATCTACGTGAGCCATCCGACGGGACCGATTATAATAAAGCCGTGGATCCAGCAGCTGCGTGAAAAACCCATATCAGTATCTCTTGTCTCTTGAAAAAACTGCGATCGCGGGCGATCGCGGAAATCTTACAGGGATGGGATAGCCTCTACATGCAGACCTAGCACCTGTGTGACATGGCCGAGAACGGTTTCTGTTATCGAGAGCACCAAAAAACAGCTTTTTGCGGCTTGTTTGCGCTTGTTTGCAATGTTAACGTCCAAGAAGTTGCTAAAACTCTCGCATTGA

Full Affymetrix probeset data:

Annotations for 1632108_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720