Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632110_at:

>probe:Drosophila_2:1632110_at:43:389; Interrogation_Position=1444; Antisense; GAAAATGTCTTCACACAGCACACTC
>probe:Drosophila_2:1632110_at:680:245; Interrogation_Position=1537; Antisense; AATTCAGAGCTTGTGCCATTTCGAC
>probe:Drosophila_2:1632110_at:339:131; Interrogation_Position=1566; Antisense; ACCGCAGGAGGTTGTCGTGTTCATT
>probe:Drosophila_2:1632110_at:614:499; Interrogation_Position=1579; Antisense; GTCGTGTTCATTATTGGCGGTGCCA
>probe:Drosophila_2:1632110_at:334:289; Interrogation_Position=1596; Antisense; CGGTGCCACGTACGAGGAAGCCTTA
>probe:Drosophila_2:1632110_at:664:379; Interrogation_Position=1612; Antisense; GAAGCCTTAGCGGTGCACCAGTTAA
>probe:Drosophila_2:1632110_at:637:319; Interrogation_Position=1626; Antisense; GCACCAGTTAAACAACGCCGGCTAT
>probe:Drosophila_2:1632110_at:224:31; Interrogation_Position=1649; Antisense; ATAAAGTCATTCTTGGCGGCACCAC
>probe:Drosophila_2:1632110_at:550:699; Interrogation_Position=1693; Antisense; TTTATCCAAGAGGTCGTGGCCGCCA
>probe:Drosophila_2:1632110_at:174:301; Interrogation_Position=1713; Antisense; CGCCACTAGTGGCATTCAGTTTAAG
>probe:Drosophila_2:1632110_at:85:479; Interrogation_Position=1731; Antisense; GTTTAAGCACACCAAATCCATGATC
>probe:Drosophila_2:1632110_at:103:455; Interrogation_Position=1752; Antisense; GATCAAGTACTGTTCCACGGATAAC
>probe:Drosophila_2:1632110_at:580:497; Interrogation_Position=1784; Antisense; GTCTATTTTGACTAGATAGCCCCAA
>probe:Drosophila_2:1632110_at:584:433; Interrogation_Position=1947; Antisense; GAGGGTAACACCAGGCAACGCCTTG

Paste this into a BLAST search page for me
GAAAATGTCTTCACACAGCACACTCAATTCAGAGCTTGTGCCATTTCGACACCGCAGGAGGTTGTCGTGTTCATTGTCGTGTTCATTATTGGCGGTGCCACGGTGCCACGTACGAGGAAGCCTTAGAAGCCTTAGCGGTGCACCAGTTAAGCACCAGTTAAACAACGCCGGCTATATAAAGTCATTCTTGGCGGCACCACTTTATCCAAGAGGTCGTGGCCGCCACGCCACTAGTGGCATTCAGTTTAAGGTTTAAGCACACCAAATCCATGATCGATCAAGTACTGTTCCACGGATAACGTCTATTTTGACTAGATAGCCCCAAGAGGGTAACACCAGGCAACGCCTTG

Full Affymetrix probeset data:

Annotations for 1632110_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime