FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632111_at:

>probe:Drosophila_2:1632111_at:303:409; Interrogation_Position=1006; Antisense; GACGAGGATGTCAACCTGGCTTCAT
>probe:Drosophila_2:1632111_at:114:51; Interrogation_Position=1064; Antisense; ATGCCTGTGGTATTGTCATCTCGTA
>probe:Drosophila_2:1632111_at:636:489; Interrogation_Position=1086; Antisense; GTACTCGGTGCGCATTAAGCTCAAC
>probe:Drosophila_2:1632111_at:105:255; Interrogation_Position=1107; Antisense; CAACTGCGGCACTCTGGGAGGTGAA
>probe:Drosophila_2:1632111_at:253:395; Interrogation_Position=1129; Antisense; GAAATGCAGACGGATGTGCCCTTCA
>probe:Drosophila_2:1632111_at:496:201; Interrogation_Position=1163; Antisense; AACCGGCACCTGGAACCATTGAGAA
>probe:Drosophila_2:1632111_at:139:233; Interrogation_Position=1212; Antisense; AATGAAGTCCATCGAGCAGCACCGC
>probe:Drosophila_2:1632111_at:165:383; Interrogation_Position=1314; Antisense; GAACATGGCGGACTAGGCCACCGAT
>probe:Drosophila_2:1632111_at:729:249; Interrogation_Position=1342; Antisense; CAATCTCTTCTAGCTCTGTTGTGAA
>probe:Drosophila_2:1632111_at:494:693; Interrogation_Position=1398; Antisense; TTTGTTGCAGCAGTCTCTCGTGGAG
>probe:Drosophila_2:1632111_at:428:545; Interrogation_Position=1468; Antisense; GGATCTGGAGTTTGTACCCGTACAT
>probe:Drosophila_2:1632111_at:634:385; Interrogation_Position=1510; Antisense; GAACAGACCTCGTGTCGCTATATTA
>probe:Drosophila_2:1632111_at:76:187; Interrogation_Position=964; Antisense; AACAAGGATCGCCATGGTATCGCCC
>probe:Drosophila_2:1632111_at:526:483; Interrogation_Position=980; Antisense; GTATCGCCCTGGATGGTCACTTGAA

Paste this into a BLAST search page for me
GACGAGGATGTCAACCTGGCTTCATATGCCTGTGGTATTGTCATCTCGTAGTACTCGGTGCGCATTAAGCTCAACCAACTGCGGCACTCTGGGAGGTGAAGAAATGCAGACGGATGTGCCCTTCAAACCGGCACCTGGAACCATTGAGAAAATGAAGTCCATCGAGCAGCACCGCGAACATGGCGGACTAGGCCACCGATCAATCTCTTCTAGCTCTGTTGTGAATTTGTTGCAGCAGTCTCTCGTGGAGGGATCTGGAGTTTGTACCCGTACATGAACAGACCTCGTGTCGCTATATTAAACAAGGATCGCCATGGTATCGCCCGTATCGCCCTGGATGGTCACTTGAA

Full Affymetrix probeset data:

Annotations for 1632111_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720