Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632114_at:

>probe:Drosophila_2:1632114_at:499:363; Interrogation_Position=1172; Antisense; GAATTCCGAATTCACTGAAGCATCG
>probe:Drosophila_2:1632114_at:45:263; Interrogation_Position=1239; Antisense; CAGCGATTGCATCCCCTGATTGTGG
>probe:Drosophila_2:1632114_at:262:465; Interrogation_Position=1256; Antisense; GATTGTGGGAAATGCTCGCGTCCTT
>probe:Drosophila_2:1632114_at:518:635; Interrogation_Position=1271; Antisense; TCGCGTCCTTGCCAGAGATGCTGTC
>probe:Drosophila_2:1632114_at:582:445; Interrogation_Position=1287; Antisense; GATGCTGTCCTCAGTGGATACCGAG
>probe:Drosophila_2:1632114_at:169:503; Interrogation_Position=1311; Antisense; GTGCCAGCTGGAACTTACGTGAACA
>probe:Drosophila_2:1632114_at:263:509; Interrogation_Position=1329; Antisense; GTGAACATTGTTCCCCTGAATGCCC
>probe:Drosophila_2:1632114_at:412:607; Interrogation_Position=1364; Antisense; TGAGTACTTCCCACAGGCATCTGAG
>probe:Drosophila_2:1632114_at:198:201; Interrogation_Position=1399; Antisense; AACGCTGGCTGCGAAGTCCCAAGGA
>probe:Drosophila_2:1632114_at:270:367; Interrogation_Position=1428; Antisense; GAATCGAAGTGTCCGGCAAATGAAC
>probe:Drosophila_2:1632114_at:58:589; Interrogation_Position=1576; Antisense; TGGAGTTCAATTATCCCACGGAGAA
>probe:Drosophila_2:1632114_at:570:51; Interrogation_Position=1600; Antisense; ATGCGTTCCGATCTGCATTGATCAA
>probe:Drosophila_2:1632114_at:556:603; Interrogation_Position=1618; Antisense; TGATCAACTTGCCAAACATTCCGCT
>probe:Drosophila_2:1632114_at:392:633; Interrogation_Position=1637; Antisense; TCCGCTCAAGTTTAAATTCATCGAT

Paste this into a BLAST search page for me
GAATTCCGAATTCACTGAAGCATCGCAGCGATTGCATCCCCTGATTGTGGGATTGTGGGAAATGCTCGCGTCCTTTCGCGTCCTTGCCAGAGATGCTGTCGATGCTGTCCTCAGTGGATACCGAGGTGCCAGCTGGAACTTACGTGAACAGTGAACATTGTTCCCCTGAATGCCCTGAGTACTTCCCACAGGCATCTGAGAACGCTGGCTGCGAAGTCCCAAGGAGAATCGAAGTGTCCGGCAAATGAACTGGAGTTCAATTATCCCACGGAGAAATGCGTTCCGATCTGCATTGATCAATGATCAACTTGCCAAACATTCCGCTTCCGCTCAAGTTTAAATTCATCGAT

Full Affymetrix probeset data:

Annotations for 1632114_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime