FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632116_at:

>probe:Drosophila_2:1632116_at:104:533; Interrogation_Position=1795; Antisense; GGGTGGCTTCTTTATTGCTGCGTCA
>probe:Drosophila_2:1632116_at:109:621; Interrogation_Position=1810; Antisense; TGCTGCGTCAGTTGTTTCTTTAATG
>probe:Drosophila_2:1632116_at:333:171; Interrogation_Position=1855; Antisense; AAAGATCTCCTTGCGACCCAGGGTG
>probe:Drosophila_2:1632116_at:447:575; Interrogation_Position=1904; Antisense; GGCGTGAGCATGATCTACGTGCCAT
>probe:Drosophila_2:1632116_at:103:617; Interrogation_Position=1947; Antisense; TGCCATTGCGAACGGAGCCCAGTAG
>probe:Drosophila_2:1632116_at:368:465; Interrogation_Position=1971; Antisense; GTTGGCGCATCCTGCTGTTGTGCAA
>probe:Drosophila_2:1632116_at:228:603; Interrogation_Position=1986; Antisense; TGTTGTGCAACCAGGTGCCCGGAAT
>probe:Drosophila_2:1632116_at:50:33; Interrogation_Position=2018; Antisense; ATAATCATTCTGGTATTCCTGCCCG
>probe:Drosophila_2:1632116_at:168:689; Interrogation_Position=2031; Antisense; TATTCCTGCCCGAGAGTCCAAAGTA
>probe:Drosophila_2:1632116_at:125:77; Interrogation_Position=2188; Antisense; AGGTTTTGCCCTGCCAATATGGATG
>probe:Drosophila_2:1632116_at:618:707; Interrogation_Position=2229; Antisense; TTACGGCCACGTTCACTGATTGGGA
>probe:Drosophila_2:1632116_at:648:3; Interrogation_Position=2247; Antisense; ATTGGGATACGATGTGCTCTCACTT
>probe:Drosophila_2:1632116_at:190:13; Interrogation_Position=2279; Antisense; ATTAAAGCAGATTCGCCTGGCCGTA
>probe:Drosophila_2:1632116_at:613:29; Interrogation_Position=2345; Antisense; ATACTTCCTGTTTCTTGCAGTGCCA

Paste this into a BLAST search page for me
GGGTGGCTTCTTTATTGCTGCGTCATGCTGCGTCAGTTGTTTCTTTAATGAAAGATCTCCTTGCGACCCAGGGTGGGCGTGAGCATGATCTACGTGCCATTGCCATTGCGAACGGAGCCCAGTAGGTTGGCGCATCCTGCTGTTGTGCAATGTTGTGCAACCAGGTGCCCGGAATATAATCATTCTGGTATTCCTGCCCGTATTCCTGCCCGAGAGTCCAAAGTAAGGTTTTGCCCTGCCAATATGGATGTTACGGCCACGTTCACTGATTGGGAATTGGGATACGATGTGCTCTCACTTATTAAAGCAGATTCGCCTGGCCGTAATACTTCCTGTTTCTTGCAGTGCCA

Full Affymetrix probeset data:

Annotations for 1632116_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720