Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632120_at:

>probe:Drosophila_2:1632120_at:214:543; Interrogation_Position=1629; Antisense; GGATTTACAACCTGACTGCTGCCAA
>probe:Drosophila_2:1632120_at:139:615; Interrogation_Position=1656; Antisense; TGAAGCCAGATGAACAGCCCGAGTG
>probe:Drosophila_2:1632120_at:285:519; Interrogation_Position=1678; Antisense; GTGGTTCCTGGAGTACGAGTTCATC
>probe:Drosophila_2:1632120_at:116:431; Interrogation_Position=1723; Antisense; GAGTCCGGCCGGAATCAGCAAGCTG
>probe:Drosophila_2:1632120_at:550:441; Interrogation_Position=1751; Antisense; GATGAGTTCGCCGAGAATCCCGAAT
>probe:Drosophila_2:1632120_at:123:169; Interrogation_Position=1783; Antisense; AAAGTACTGGCGCTACCGAGTGACC
>probe:Drosophila_2:1632120_at:705:65; Interrogation_Position=1827; Antisense; ATGGAGGTTGTGATCGCAGCTGCTT
>probe:Drosophila_2:1632120_at:606:285; Interrogation_Position=1875; Antisense; CTGTGACCATCAATTCCGAGCGAGA
>probe:Drosophila_2:1632120_at:185:423; Interrogation_Position=1919; Antisense; GAGAAGTTGTTTGCCTCGCTGGACA
>probe:Drosophila_2:1632120_at:269:425; Interrogation_Position=1949; Antisense; GAGAGCACATCGTCGTCGGGAAGCA
>probe:Drosophila_2:1632120_at:91:549; Interrogation_Position=2030; Antisense; GGAGGATCCTCCACTTTGGGACTGC
>probe:Drosophila_2:1632120_at:252:315; Interrogation_Position=2094; Antisense; GCCTAGCCTTGTAGTAATCCTCATT
>probe:Drosophila_2:1632120_at:161:493; Interrogation_Position=2163; Antisense; GTAACCGCTCTCAAGTGGCAAATAG
>probe:Drosophila_2:1632120_at:618:109; Interrogation_Position=2186; Antisense; AGAAGTATGCGCTTATCCCTATCGA

Paste this into a BLAST search page for me
GGATTTACAACCTGACTGCTGCCAATGAAGCCAGATGAACAGCCCGAGTGGTGGTTCCTGGAGTACGAGTTCATCGAGTCCGGCCGGAATCAGCAAGCTGGATGAGTTCGCCGAGAATCCCGAATAAAGTACTGGCGCTACCGAGTGACCATGGAGGTTGTGATCGCAGCTGCTTCTGTGACCATCAATTCCGAGCGAGAGAGAAGTTGTTTGCCTCGCTGGACAGAGAGCACATCGTCGTCGGGAAGCAGGAGGATCCTCCACTTTGGGACTGCGCCTAGCCTTGTAGTAATCCTCATTGTAACCGCTCTCAAGTGGCAAATAGAGAAGTATGCGCTTATCCCTATCGA

Full Affymetrix probeset data:

Annotations for 1632120_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime