Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632123_at:

>probe:Drosophila_2:1632123_at:347:125; Interrogation_Position=2593; Antisense; AGCCCGCCGCAACAGACATTATTTT
>probe:Drosophila_2:1632123_at:497:377; Interrogation_Position=2618; Antisense; GAAGCACGCGACTTTCGGAATCCAT
>probe:Drosophila_2:1632123_at:276:235; Interrogation_Position=2636; Antisense; AATCCATGTGATCAAGCCGCAGCAG
>probe:Drosophila_2:1632123_at:613:263; Interrogation_Position=2658; Antisense; CAGGCTTCCGGTGAATCCTTGGAGA
>probe:Drosophila_2:1632123_at:229:377; Interrogation_Position=2709; Antisense; GAAGAACACAGTGCCGTTAACGCGT
>probe:Drosophila_2:1632123_at:501:473; Interrogation_Position=2724; Antisense; GTTAACGCGTTTGTCAATCTTTCCG
>probe:Drosophila_2:1632123_at:477:49; Interrogation_Position=2757; Antisense; ATGCCTGCCATGAGCCTGATTTGTG
>probe:Drosophila_2:1632123_at:269:613; Interrogation_Position=2791; Antisense; TGAAATCGCTGCTTATTCCGGCGGA
>probe:Drosophila_2:1632123_at:506:435; Interrogation_Position=2943; Antisense; GAGGCAAGGAACACGCTGGACACCC
>probe:Drosophila_2:1632123_at:10:587; Interrogation_Position=2959; Antisense; TGGACACCCGGAAAACGCTGCTGGA
>probe:Drosophila_2:1632123_at:329:55; Interrogation_Position=2989; Antisense; ATGAAAAGCTGGTGGACCTGCCGCT
>probe:Drosophila_2:1632123_at:14:555; Interrogation_Position=3002; Antisense; GGACCTGCCGCTTGAGGGAGAAACT
>probe:Drosophila_2:1632123_at:702:389; Interrogation_Position=3021; Antisense; GAAACTGACCTGCAGGGCCTTGATA
>probe:Drosophila_2:1632123_at:468:457; Interrogation_Position=3049; Antisense; GATTAAGGACCATCACGGCGTTGAG

Paste this into a BLAST search page for me
AGCCCGCCGCAACAGACATTATTTTGAAGCACGCGACTTTCGGAATCCATAATCCATGTGATCAAGCCGCAGCAGCAGGCTTCCGGTGAATCCTTGGAGAGAAGAACACAGTGCCGTTAACGCGTGTTAACGCGTTTGTCAATCTTTCCGATGCCTGCCATGAGCCTGATTTGTGTGAAATCGCTGCTTATTCCGGCGGAGAGGCAAGGAACACGCTGGACACCCTGGACACCCGGAAAACGCTGCTGGAATGAAAAGCTGGTGGACCTGCCGCTGGACCTGCCGCTTGAGGGAGAAACTGAAACTGACCTGCAGGGCCTTGATAGATTAAGGACCATCACGGCGTTGAG

Full Affymetrix probeset data:

Annotations for 1632123_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime