FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632131_at:

>probe:Drosophila_2:1632131_at:548:279; Interrogation_Position=2940; Antisense; CTCTGGGCTGTTTAAAGTACCGCGT
>probe:Drosophila_2:1632131_at:412:303; Interrogation_Position=2959; Antisense; CCGCGTTGGTATAGTTTATTTAGCA
>probe:Drosophila_2:1632131_at:528:195; Interrogation_Position=3009; Antisense; AACTGAGAGTTTGATCATGTCCGTT
>probe:Drosophila_2:1632131_at:363:453; Interrogation_Position=3021; Antisense; GATCATGTCCGTTAATTGTCTATAA
>probe:Drosophila_2:1632131_at:351:349; Interrogation_Position=3134; Antisense; GCAGAGCAAATATTACCTTTCCCCG
>probe:Drosophila_2:1632131_at:23:87; Interrogation_Position=3206; Antisense; AGTGCTAGTAGTGCGTATCTCTGTA
>probe:Drosophila_2:1632131_at:130:329; Interrogation_Position=3218; Antisense; GCGTATCTCTGTATATGTGCACCCC
>probe:Drosophila_2:1632131_at:656:61; Interrogation_Position=3258; Antisense; ATGTGCGAATTGTAGACGACTCCTC
>probe:Drosophila_2:1632131_at:450:409; Interrogation_Position=3272; Antisense; GACGACTCCTCTAAATGTAACTTGT
>probe:Drosophila_2:1632131_at:715:657; Interrogation_Position=3320; Antisense; TAAGCAATCGACGTGGTGCGTGCCA
>probe:Drosophila_2:1632131_at:141:565; Interrogation_Position=3400; Antisense; TGTGACAGGTTTCTACGGTTCCTTT
>probe:Drosophila_2:1632131_at:419:479; Interrogation_Position=3428; Antisense; GTTTCGAAAACAATCAGCACCGGAT
>probe:Drosophila_2:1632131_at:72:353; Interrogation_Position=3444; Antisense; GCACCGGATATGAGACACAATCGTT
>probe:Drosophila_2:1632131_at:550:475; Interrogation_Position=3466; Antisense; GTTATCGAATCTATTGATACCTCCC

Paste this into a BLAST search page for me
CTCTGGGCTGTTTAAAGTACCGCGTCCGCGTTGGTATAGTTTATTTAGCAAACTGAGAGTTTGATCATGTCCGTTGATCATGTCCGTTAATTGTCTATAAGCAGAGCAAATATTACCTTTCCCCGAGTGCTAGTAGTGCGTATCTCTGTAGCGTATCTCTGTATATGTGCACCCCATGTGCGAATTGTAGACGACTCCTCGACGACTCCTCTAAATGTAACTTGTTAAGCAATCGACGTGGTGCGTGCCATGTGACAGGTTTCTACGGTTCCTTTGTTTCGAAAACAATCAGCACCGGATGCACCGGATATGAGACACAATCGTTGTTATCGAATCTATTGATACCTCCC

Full Affymetrix probeset data:

Annotations for 1632131_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720