Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632132_at:

>probe:Drosophila_2:1632132_at:105:729; Interrogation_Position=118; Antisense; TTGGTGGCCGCGATTGCCCTGCGCC
>probe:Drosophila_2:1632132_at:479:269; Interrogation_Position=242; Antisense; CATCTGCAGCAACATTAGAAGCGGC
>probe:Drosophila_2:1632132_at:721:675; Interrogation_Position=257; Antisense; TAGAAGCGGCAACAACGCGCAGGAT
>probe:Drosophila_2:1632132_at:140:187; Interrogation_Position=267; Antisense; AACAACGCGCAGGATACGCCACAAG
>probe:Drosophila_2:1632132_at:292:349; Interrogation_Position=275; Antisense; GCAGGATACGCCACAAGCGTCGCTC
>probe:Drosophila_2:1632132_at:676:1; Interrogation_Position=33; Antisense; ATTTATTTTCCGCTTGGCAATCGTT
>probe:Drosophila_2:1632132_at:142:319; Interrogation_Position=41; Antisense; TCCGCTTGGCAATCGTTTTAGGTCG
>probe:Drosophila_2:1632132_at:602:249; Interrogation_Position=50; Antisense; CAATCGTTTTAGGTCGTTTGTTGCT
>probe:Drosophila_2:1632132_at:603:385; Interrogation_Position=598; Antisense; GAACATTCTGTACCCGTCACATGGC
>probe:Drosophila_2:1632132_at:74:601; Interrogation_Position=606; Antisense; TGTACCCGTCACATGGCGTCATTGA
>probe:Drosophila_2:1632132_at:148:535; Interrogation_Position=61; Antisense; GGTCGTTTGTTGCTAATCGCCATTA
>probe:Drosophila_2:1632132_at:327:45; Interrogation_Position=76; Antisense; ATCGCCATTAGTTTATCCGTGTGCC
>probe:Drosophila_2:1632132_at:215:15; Interrogation_Position=82; Antisense; ATTAGTTTATCCGTGTGCCTGGCCT
>probe:Drosophila_2:1632132_at:433:47; Interrogation_Position=90; Antisense; ATCCGTGTGCCTGGCCTGTGGCAGT

Paste this into a BLAST search page for me
TTGGTGGCCGCGATTGCCCTGCGCCCATCTGCAGCAACATTAGAAGCGGCTAGAAGCGGCAACAACGCGCAGGATAACAACGCGCAGGATACGCCACAAGGCAGGATACGCCACAAGCGTCGCTCATTTATTTTCCGCTTGGCAATCGTTTCCGCTTGGCAATCGTTTTAGGTCGCAATCGTTTTAGGTCGTTTGTTGCTGAACATTCTGTACCCGTCACATGGCTGTACCCGTCACATGGCGTCATTGAGGTCGTTTGTTGCTAATCGCCATTAATCGCCATTAGTTTATCCGTGTGCCATTAGTTTATCCGTGTGCCTGGCCTATCCGTGTGCCTGGCCTGTGGCAGT

Full Affymetrix probeset data:

Annotations for 1632132_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime