FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632136_at:

>probe:Drosophila_2:1632136_at:659:651; Interrogation_Position=2574; Antisense; TCAACAGTGATTTCCGCGAGGGTCA
>probe:Drosophila_2:1632136_at:109:119; Interrogation_Position=2613; Antisense; AGCTGCCAGATTACACTGCCAGTGG
>probe:Drosophila_2:1632136_at:435:405; Interrogation_Position=2637; Antisense; GACTGCGCTACTTTCTGCATTTAAT
>probe:Drosophila_2:1632136_at:185:329; Interrogation_Position=2730; Antisense; GCGTGTACATCATGCCCGATATGGA
>probe:Drosophila_2:1632136_at:14:619; Interrogation_Position=2763; Antisense; TGCAGCAAAGACTCATCCAGTACCT
>probe:Drosophila_2:1632136_at:314:613; Interrogation_Position=2826; Antisense; TGAAGAACTACCATGCCGACCTGAC
>probe:Drosophila_2:1632136_at:318:407; Interrogation_Position=2848; Antisense; GACGGAAACTGCCATCAGCTTTTAT
>probe:Drosophila_2:1632136_at:240:387; Interrogation_Position=2897; Antisense; GAAAAGCTTCAGCTGTTCCGGGCAG
>probe:Drosophila_2:1632136_at:514:119; Interrogation_Position=2955; Antisense; AGCTGCTCAACGATGCGGTGTTCGA
>probe:Drosophila_2:1632136_at:600:597; Interrogation_Position=2984; Antisense; TGTCGCGGCTATGTCTTCTAGACAC
>probe:Drosophila_2:1632136_at:421:133; Interrogation_Position=3013; Antisense; ACCCAGTTGCGTTCTGTGATCACAT
>probe:Drosophila_2:1632136_at:45:597; Interrogation_Position=3027; Antisense; TGTGATCACATTTTGGCGTTTTCCA
>probe:Drosophila_2:1632136_at:465:1; Interrogation_Position=3051; Antisense; ATTCCCTGGATTCAGCTCGTTTTAT
>probe:Drosophila_2:1632136_at:705:153; Interrogation_Position=3081; Antisense; ACAGCCCTTAGCCAAGTATTCCAAT

Paste this into a BLAST search page for me
TCAACAGTGATTTCCGCGAGGGTCAAGCTGCCAGATTACACTGCCAGTGGGACTGCGCTACTTTCTGCATTTAATGCGTGTACATCATGCCCGATATGGATGCAGCAAAGACTCATCCAGTACCTTGAAGAACTACCATGCCGACCTGACGACGGAAACTGCCATCAGCTTTTATGAAAAGCTTCAGCTGTTCCGGGCAGAGCTGCTCAACGATGCGGTGTTCGATGTCGCGGCTATGTCTTCTAGACACACCCAGTTGCGTTCTGTGATCACATTGTGATCACATTTTGGCGTTTTCCAATTCCCTGGATTCAGCTCGTTTTATACAGCCCTTAGCCAAGTATTCCAAT

Full Affymetrix probeset data:

Annotations for 1632136_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720