FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632138_at:

>probe:Drosophila_2:1632138_at:549:567; Interrogation_Position=249; Antisense; GGCCATGTACGAGGGTCAACCGGAT
>probe:Drosophila_2:1632138_at:10:463; Interrogation_Position=271; Antisense; GATTCGTTGGTCTTGGTTGAGTGCA
>probe:Drosophila_2:1632138_at:276:213; Interrogation_Position=311; Antisense; AAGACCAGGACTTCCACAGTGTGCC
>probe:Drosophila_2:1632138_at:580:123; Interrogation_Position=379; Antisense; ACCACGTATATTCCGGACCATTTGC
>probe:Drosophila_2:1632138_at:691:521; Interrogation_Position=416; Antisense; GGGCGCACACCTATAAGAGTTCGAC
>probe:Drosophila_2:1632138_at:131:707; Interrogation_Position=452; Antisense; TTACGGATCGCAGCTATGTGGCCAT
>probe:Drosophila_2:1632138_at:670:235; Interrogation_Position=481; Antisense; AATCGCCATGCCGAGAATGAGCTGA
>probe:Drosophila_2:1632138_at:697:53; Interrogation_Position=497; Antisense; ATGAGCTGAACACCCAAAACGCCTT
>probe:Drosophila_2:1632138_at:594:79; Interrogation_Position=538; Antisense; AGGTGCAACCCCAATATATCGCTGT
>probe:Drosophila_2:1632138_at:394:515; Interrogation_Position=587; Antisense; GTGGCCACGTTTTGGATCTAGGTCC
>probe:Drosophila_2:1632138_at:481:689; Interrogation_Position=628; Antisense; TATTCGGACGCCCTGATGCCAAGAA
>probe:Drosophila_2:1632138_at:509:725; Interrogation_Position=662; Antisense; TTGATACGGACATCTATGCTCCCAT
>probe:Drosophila_2:1632138_at:80:53; Interrogation_Position=677; Antisense; ATGCTCCCATCGAGGTGATAACCCA
>probe:Drosophila_2:1632138_at:578:405; Interrogation_Position=712; Antisense; GACTGCCGTTACTTGGAGAAGCCCA

Paste this into a BLAST search page for me
GGCCATGTACGAGGGTCAACCGGATGATTCGTTGGTCTTGGTTGAGTGCAAAGACCAGGACTTCCACAGTGTGCCACCACGTATATTCCGGACCATTTGCGGGCGCACACCTATAAGAGTTCGACTTACGGATCGCAGCTATGTGGCCATAATCGCCATGCCGAGAATGAGCTGAATGAGCTGAACACCCAAAACGCCTTAGGTGCAACCCCAATATATCGCTGTGTGGCCACGTTTTGGATCTAGGTCCTATTCGGACGCCCTGATGCCAAGAATTGATACGGACATCTATGCTCCCATATGCTCCCATCGAGGTGATAACCCAGACTGCCGTTACTTGGAGAAGCCCA

Full Affymetrix probeset data:

Annotations for 1632138_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720