FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632139_at:

>probe:Drosophila_2:1632139_at:707:633; Interrogation_Position=1061; Antisense; TAAAGTAACTTCACAAGCGACGGTT
>probe:Drosophila_2:1632139_at:283:609; Interrogation_Position=548; Antisense; TGAGCTCCTTGCAGGCCGGCAAAAG
>probe:Drosophila_2:1632139_at:645:505; Interrogation_Position=572; Antisense; GTGCCATACTTTACAACAAACTGCG
>probe:Drosophila_2:1632139_at:257:95; Interrogation_Position=602; Antisense; AGATTGCTAACTTTCCGCAGGTGGA
>probe:Drosophila_2:1632139_at:624:421; Interrogation_Position=646; Antisense; GAGAATCAAGAGCTTCCTGCCAGAT
>probe:Drosophila_2:1632139_at:339:627; Interrogation_Position=663; Antisense; TGCCAGATTAGAACCTCCAACGAGA
>probe:Drosophila_2:1632139_at:439:127; Interrogation_Position=717; Antisense; ACCAGACATTGTCCTGATACCGAAA
>probe:Drosophila_2:1632139_at:35:581; Interrogation_Position=776; Antisense; TGGCCAAATCTGATGTGGGCACCAT
>probe:Drosophila_2:1632139_at:676:719; Interrogation_Position=803; Antisense; TTGCCAGGAAGGAAACACCCGTTCA
>probe:Drosophila_2:1632139_at:231:53; Interrogation_Position=851; Antisense; ATGAAAACGTTCTGGCCACGGTGGC
>probe:Drosophila_2:1632139_at:442:217; Interrogation_Position=886; Antisense; AAGTTCATTGAACGCGAGTCGCAGG
>probe:Drosophila_2:1632139_at:246:365; Interrogation_Position=921; Antisense; GAATCCTCCTCCAGAAAGTTGTTTT
>probe:Drosophila_2:1632139_at:331:333; Interrogation_Position=972; Antisense; GCTGGCCGCACAGACGATGTTCAAT
>probe:Drosophila_2:1632139_at:49:443; Interrogation_Position=987; Antisense; GATGTTCAATCGCAAGTTGTCCAAG

Paste this into a BLAST search page for me
TAAAGTAACTTCACAAGCGACGGTTTGAGCTCCTTGCAGGCCGGCAAAAGGTGCCATACTTTACAACAAACTGCGAGATTGCTAACTTTCCGCAGGTGGAGAGAATCAAGAGCTTCCTGCCAGATTGCCAGATTAGAACCTCCAACGAGAACCAGACATTGTCCTGATACCGAAATGGCCAAATCTGATGTGGGCACCATTTGCCAGGAAGGAAACACCCGTTCAATGAAAACGTTCTGGCCACGGTGGCAAGTTCATTGAACGCGAGTCGCAGGGAATCCTCCTCCAGAAAGTTGTTTTGCTGGCCGCACAGACGATGTTCAATGATGTTCAATCGCAAGTTGTCCAAG

Full Affymetrix probeset data:

Annotations for 1632139_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720