FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632140_at:

>probe:Drosophila_2:1632140_at:553:651; Interrogation_Position=120; Antisense; TCAACCCGATTAAGCAAGGTGCGCG
>probe:Drosophila_2:1632140_at:136:303; Interrogation_Position=124; Antisense; CCCGATTAAGCAAGGTGCGCGAAAT
>probe:Drosophila_2:1632140_at:601:393; Interrogation_Position=144; Antisense; GAAATCCGCCCGAGACTCGACTATG
>probe:Drosophila_2:1632140_at:134:633; Interrogation_Position=148; Antisense; TCCGCCCGAGACTCGACTATGTGGA
>probe:Drosophila_2:1632140_at:556:75; Interrogation_Position=172; Antisense; AGGAGGTGGCCTATGTCATCCTCCG
>probe:Drosophila_2:1632140_at:487:599; Interrogation_Position=185; Antisense; TGTCATCCTCCGTCTATTACATAAG
>probe:Drosophila_2:1632140_at:106:629; Interrogation_Position=190; Antisense; TCCTCCGTCTATTACATAAGGTAGT
>probe:Drosophila_2:1632140_at:484:31; Interrogation_Position=205; Antisense; ATAAGGTAGTTTTATGGGATGCACC
>probe:Drosophila_2:1632140_at:123:477; Interrogation_Position=213; Antisense; GTTTTATGGGATGCACCTTGGGATT
>probe:Drosophila_2:1632140_at:596:443; Interrogation_Position=222; Antisense; GATGCACCTTGGGATTTATTTCGGG
>probe:Drosophila_2:1632140_at:401:405; Interrogation_Position=44; Antisense; GACTCTATCTGGAGGTCCACAGGAT
>probe:Drosophila_2:1632140_at:161:277; Interrogation_Position=48; Antisense; CTATCTGGAGGTCCACAGGATCTGT
>probe:Drosophila_2:1632140_at:569:639; Interrogation_Position=68; Antisense; TCTGTCAACGACAAGGTGTTGGGTG
>probe:Drosophila_2:1632140_at:238:161; Interrogation_Position=78; Antisense; ACAAGGTGTTGGGTGGCAACAGCAA

Paste this into a BLAST search page for me
TCAACCCGATTAAGCAAGGTGCGCGCCCGATTAAGCAAGGTGCGCGAAATGAAATCCGCCCGAGACTCGACTATGTCCGCCCGAGACTCGACTATGTGGAAGGAGGTGGCCTATGTCATCCTCCGTGTCATCCTCCGTCTATTACATAAGTCCTCCGTCTATTACATAAGGTAGTATAAGGTAGTTTTATGGGATGCACCGTTTTATGGGATGCACCTTGGGATTGATGCACCTTGGGATTTATTTCGGGGACTCTATCTGGAGGTCCACAGGATCTATCTGGAGGTCCACAGGATCTGTTCTGTCAACGACAAGGTGTTGGGTGACAAGGTGTTGGGTGGCAACAGCAA

Full Affymetrix probeset data:

Annotations for 1632140_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720