FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632141_at:

>probe:Drosophila_2:1632141_at:184:369; Interrogation_Position=5876; Antisense; GAATGCTACCTCAGACGGACTTGAA
>probe:Drosophila_2:1632141_at:10:641; Interrogation_Position=5937; Antisense; TCTACGATACCATACGAAACCCTTC
>probe:Drosophila_2:1632141_at:507:387; Interrogation_Position=5952; Antisense; GAAACCCTTCAAGCTAAATCTAATT
>probe:Drosophila_2:1632141_at:512:515; Interrogation_Position=5979; Antisense; GTGTAGTGACTTTACCTCAAACAGA
>probe:Drosophila_2:1632141_at:634:361; Interrogation_Position=6002; Antisense; GAATTACACCTTACTTTATTCACAG
>probe:Drosophila_2:1632141_at:343:181; Interrogation_Position=6173; Antisense; AAAACAGATCCATCAACTCTTCAGT
>probe:Drosophila_2:1632141_at:475:191; Interrogation_Position=6187; Antisense; AACTCTTCAGTTTTGGGCGACGATT
>probe:Drosophila_2:1632141_at:400:589; Interrogation_Position=6200; Antisense; TGGGCGACGATTTTCGGGTATTATT
>probe:Drosophila_2:1632141_at:60:473; Interrogation_Position=6244; Antisense; GTTCTTTGGCGAGAAGAGTTGCCCA
>probe:Drosophila_2:1632141_at:231:167; Interrogation_Position=6269; Antisense; AAATGAGTTGATCGCTCCGAGAAGA
>probe:Drosophila_2:1632141_at:186:545; Interrogation_Position=6298; Antisense; GGATCGGCGAAGAACTATTTGCTAT
>probe:Drosophila_2:1632141_at:64:477; Interrogation_Position=6352; Antisense; GTTTTTTAAAATGCTGCGTGCCTTT
>probe:Drosophila_2:1632141_at:5:19; Interrogation_Position=6368; Antisense; CGTGCCTTTTAGCAAATACTTCGCC
>probe:Drosophila_2:1632141_at:133:163; Interrogation_Position=6381; Antisense; AAATACTTCGCCGAGTCCACAACAA

Paste this into a BLAST search page for me
GAATGCTACCTCAGACGGACTTGAATCTACGATACCATACGAAACCCTTCGAAACCCTTCAAGCTAAATCTAATTGTGTAGTGACTTTACCTCAAACAGAGAATTACACCTTACTTTATTCACAGAAAACAGATCCATCAACTCTTCAGTAACTCTTCAGTTTTGGGCGACGATTTGGGCGACGATTTTCGGGTATTATTGTTCTTTGGCGAGAAGAGTTGCCCAAAATGAGTTGATCGCTCCGAGAAGAGGATCGGCGAAGAACTATTTGCTATGTTTTTTAAAATGCTGCGTGCCTTTCGTGCCTTTTAGCAAATACTTCGCCAAATACTTCGCCGAGTCCACAACAA

Full Affymetrix probeset data:

Annotations for 1632141_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720