FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632142_at:

>probe:Drosophila_2:1632142_at:586:167; Interrogation_Position=231; Antisense; AAATGTTCGGCGACAAACCCAGCGA
>probe:Drosophila_2:1632142_at:305:413; Interrogation_Position=261; Antisense; GACCTGCTCGTTCCGATTTGATAGT
>probe:Drosophila_2:1632142_at:70:459; Interrogation_Position=275; Antisense; GATTTGATAGTTTTGGTGGCCCACA
>probe:Drosophila_2:1632142_at:142:99; Interrogation_Position=318; Antisense; AGATGTTCGTCTTCTTTCCCGAGGA
>probe:Drosophila_2:1632142_at:466:239; Interrogation_Position=364; Antisense; AATCAAGACGTACTGCACTCGCATG
>probe:Drosophila_2:1632142_at:41:73; Interrogation_Position=390; Antisense; AGGAAGAGAACATCCACCGGGCCAT
>probe:Drosophila_2:1632142_at:415:111; Interrogation_Position=450; Antisense; AGCAATCGCTCGTAGATATGGCCCC
>probe:Drosophila_2:1632142_at:214:491; Interrogation_Position=478; Antisense; GTACATCCTGGAACAGTTTCTCGAA
>probe:Drosophila_2:1632142_at:513:115; Interrogation_Position=573; Antisense; AGCAGGAGCTGCTCAGCCGTTACAA
>probe:Drosophila_2:1632142_at:37:523; Interrogation_Position=641; Antisense; GTGGCCCGGTACTTTGGACTCAAGC
>probe:Drosophila_2:1632142_at:435:123; Interrogation_Position=663; Antisense; AGCGCGGCCAGGTGGTTAAGATCAT
>probe:Drosophila_2:1632142_at:217:711; Interrogation_Position=678; Antisense; TTAAGATCATCCGTTCCTCTGAGAC
>probe:Drosophila_2:1632142_at:520:407; Interrogation_Position=700; Antisense; GACGGCGGGACGGTACATATCCTAT
>probe:Drosophila_2:1632142_at:169:43; Interrogation_Position=723; Antisense; ATCGATTGGTGTGCTGATCCTGGAC

Paste this into a BLAST search page for me
AAATGTTCGGCGACAAACCCAGCGAGACCTGCTCGTTCCGATTTGATAGTGATTTGATAGTTTTGGTGGCCCACAAGATGTTCGTCTTCTTTCCCGAGGAAATCAAGACGTACTGCACTCGCATGAGGAAGAGAACATCCACCGGGCCATAGCAATCGCTCGTAGATATGGCCCCGTACATCCTGGAACAGTTTCTCGAAAGCAGGAGCTGCTCAGCCGTTACAAGTGGCCCGGTACTTTGGACTCAAGCAGCGCGGCCAGGTGGTTAAGATCATTTAAGATCATCCGTTCCTCTGAGACGACGGCGGGACGGTACATATCCTATATCGATTGGTGTGCTGATCCTGGAC

Full Affymetrix probeset data:

Annotations for 1632142_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720