FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632143_at:

>probe:Drosophila_2:1632143_at:518:177; Interrogation_Position=19; Antisense; AAACAAGCGCCCGAAATAGACCAGC
>probe:Drosophila_2:1632143_at:638:321; Interrogation_Position=25; Antisense; GCGCCCGAAATAGACCAGCTCAATT
>probe:Drosophila_2:1632143_at:618:395; Interrogation_Position=31; Antisense; GAAATAGACCAGCTCAATTCCGATT
>probe:Drosophila_2:1632143_at:430:239; Interrogation_Position=33; Antisense; AATAGACCAGCTCAATTCCGATTTC
>probe:Drosophila_2:1632143_at:296:677; Interrogation_Position=35; Antisense; TAGACCAGCTCAATTCCGATTTCAA
>probe:Drosophila_2:1632143_at:154:415; Interrogation_Position=37; Antisense; GACCAGCTCAATTCCGATTTCAAGC
>probe:Drosophila_2:1632143_at:515:101; Interrogation_Position=41; Antisense; AGCTCAATTCCGATTTCAAGCCCCA
>probe:Drosophila_2:1632143_at:195:247; Interrogation_Position=46; Antisense; AATTCCGATTTCAAGCCCCAATCGT
>probe:Drosophila_2:1632143_at:24:695; Interrogation_Position=54; Antisense; TTTCAAGCCCCAATCGTTAGACGAG
>probe:Drosophila_2:1632143_at:198:205; Interrogation_Position=58; Antisense; AAGCCCCAATCGTTAGACGAGCACA
>probe:Drosophila_2:1632143_at:160:41; Interrogation_Position=66; Antisense; ATCGTTAGACGAGCACAGTTTGTGG
>probe:Drosophila_2:1632143_at:714:135; Interrogation_Position=74; Antisense; ACGAGCACAGTTTGTGGCGGTTCCT
>probe:Drosophila_2:1632143_at:424:111; Interrogation_Position=77; Antisense; AGCACAGTTTGTGGCGGTTCCTCCG
>probe:Drosophila_2:1632143_at:346:475; Interrogation_Position=83; Antisense; GTTTGTGGCGGTTCCTCCGCAAGGA

Paste this into a BLAST search page for me
AAACAAGCGCCCGAAATAGACCAGCGCGCCCGAAATAGACCAGCTCAATTGAAATAGACCAGCTCAATTCCGATTAATAGACCAGCTCAATTCCGATTTCTAGACCAGCTCAATTCCGATTTCAAGACCAGCTCAATTCCGATTTCAAGCAGCTCAATTCCGATTTCAAGCCCCAAATTCCGATTTCAAGCCCCAATCGTTTTCAAGCCCCAATCGTTAGACGAGAAGCCCCAATCGTTAGACGAGCACAATCGTTAGACGAGCACAGTTTGTGGACGAGCACAGTTTGTGGCGGTTCCTAGCACAGTTTGTGGCGGTTCCTCCGGTTTGTGGCGGTTCCTCCGCAAGGA

Full Affymetrix probeset data:

Annotations for 1632143_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720