FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632147_at:

>probe:Drosophila_2:1632147_at:85:223; Interrogation_Position=154; Antisense; AAGGATGCCTTTGTCCAGTTCGACA
>probe:Drosophila_2:1632147_at:323:261; Interrogation_Position=201; Antisense; CACCCGTGAGCTGGGCACATTGATG
>probe:Drosophila_2:1632147_at:287:7; Interrogation_Position=219; Antisense; ATTGATGCGCACCTTGGGCCAGAAT
>probe:Drosophila_2:1632147_at:103:313; Interrogation_Position=236; Antisense; GCCAGAATCCAACGGAGGCCGAGTT
>probe:Drosophila_2:1632147_at:207:27; Interrogation_Position=271; Antisense; ATAGCTGAGGCCGAGAACAACAACA
>probe:Drosophila_2:1632147_at:697:227; Interrogation_Position=295; Antisense; AATGGCCAACTGAACTTCACTGAGT
>probe:Drosophila_2:1632147_at:433:149; Interrogation_Position=308; Antisense; ACTTCACTGAGTTCTGCGGTATAAT
>probe:Drosophila_2:1632147_at:624:573; Interrogation_Position=403; Antisense; GGCGATGGCTTTATATCACCAGCTG
>probe:Drosophila_2:1632147_at:185:309; Interrogation_Position=421; Antisense; CCAGCTGAGCTTCGCTTTGTGATGA
>probe:Drosophila_2:1632147_at:215:237; Interrogation_Position=448; Antisense; AATCTGGGCGAAAAGGTCACCGACG
>probe:Drosophila_2:1632147_at:671:443; Interrogation_Position=486; Antisense; GATGATTCGCGAGGCTGATTTTGAT
>probe:Drosophila_2:1632147_at:239:441; Interrogation_Position=514; Antisense; GATGGCATGATCAACTACGAGGAAT
>probe:Drosophila_2:1632147_at:100:31; Interrogation_Position=638; Antisense; ATACAATTTACACTTCTCTGCGGTC
>probe:Drosophila_2:1632147_at:516:713; Interrogation_Position=651; Antisense; TTCTCTGCGGTCTAACTATTTTCGA

Paste this into a BLAST search page for me
AAGGATGCCTTTGTCCAGTTCGACACACCCGTGAGCTGGGCACATTGATGATTGATGCGCACCTTGGGCCAGAATGCCAGAATCCAACGGAGGCCGAGTTATAGCTGAGGCCGAGAACAACAACAAATGGCCAACTGAACTTCACTGAGTACTTCACTGAGTTCTGCGGTATAATGGCGATGGCTTTATATCACCAGCTGCCAGCTGAGCTTCGCTTTGTGATGAAATCTGGGCGAAAAGGTCACCGACGGATGATTCGCGAGGCTGATTTTGATGATGGCATGATCAACTACGAGGAATATACAATTTACACTTCTCTGCGGTCTTCTCTGCGGTCTAACTATTTTCGA

Full Affymetrix probeset data:

Annotations for 1632147_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720