FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632149_at:

>probe:Drosophila_2:1632149_at:369:145; Interrogation_Position=1100; Antisense; ACTCCTGGCCCACGATTATATTTGG
>probe:Drosophila_2:1632149_at:297:593; Interrogation_Position=1175; Antisense; TGGGCCGGAAATTTGTCTCACTACT
>probe:Drosophila_2:1632149_at:533:147; Interrogation_Position=1194; Antisense; ACTACTTGGACTCATGTGCATGGCT
>probe:Drosophila_2:1632149_at:67:657; Interrogation_Position=1255; Antisense; TACGGGCACATCTTCGACGATTACT
>probe:Drosophila_2:1632149_at:378:511; Interrogation_Position=1381; Antisense; GTGAAACCCTTCTTGATTGGCCTGA
>probe:Drosophila_2:1632149_at:691:1; Interrogation_Position=1396; Antisense; ATTGGCCTGATCGTGTGTTTGGAGC
>probe:Drosophila_2:1632149_at:242:591; Interrogation_Position=1437; Antisense; TGTGATCGTCAAGTTTGTTCCCACC
>probe:Drosophila_2:1632149_at:90:715; Interrogation_Position=1451; Antisense; TTGTTCCCACCGCAGAGTTCTATTA
>probe:Drosophila_2:1632149_at:604:665; Interrogation_Position=1474; Antisense; TACACGTACTTTGTCGCTGTCGGAA
>probe:Drosophila_2:1632149_at:265:591; Interrogation_Position=1505; Antisense; TGGTAATAGGCCTCGTAGCTTTTGC
>probe:Drosophila_2:1632149_at:20:677; Interrogation_Position=1520; Antisense; TAGCTTTTGCCGTTCTAATGCCAGA
>probe:Drosophila_2:1632149_at:335:175; Interrogation_Position=1544; Antisense; AAACCCGAGGATTGACGCTAAGACA
>probe:Drosophila_2:1632149_at:596:531; Interrogation_Position=1589; Antisense; GGGTCCACGATGTCATGGCCTACTA
>probe:Drosophila_2:1632149_at:83:81; Interrogation_Position=1613; Antisense; AGGTGGCTTCTATTTATTGTTTGTC

Paste this into a BLAST search page for me
ACTCCTGGCCCACGATTATATTTGGTGGGCCGGAAATTTGTCTCACTACTACTACTTGGACTCATGTGCATGGCTTACGGGCACATCTTCGACGATTACTGTGAAACCCTTCTTGATTGGCCTGAATTGGCCTGATCGTGTGTTTGGAGCTGTGATCGTCAAGTTTGTTCCCACCTTGTTCCCACCGCAGAGTTCTATTATACACGTACTTTGTCGCTGTCGGAATGGTAATAGGCCTCGTAGCTTTTGCTAGCTTTTGCCGTTCTAATGCCAGAAAACCCGAGGATTGACGCTAAGACAGGGTCCACGATGTCATGGCCTACTAAGGTGGCTTCTATTTATTGTTTGTC

Full Affymetrix probeset data:

Annotations for 1632149_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720