FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632151_at:

>probe:Drosophila_2:1632151_at:126:41; Interrogation_Position=1659; Antisense; ATCTGCACAAGATTCGAGCGCCCGT
>probe:Drosophila_2:1632151_at:466:727; Interrogation_Position=1683; Antisense; TTGGCAGCTGCGAGGGATTTGATCT
>probe:Drosophila_2:1632151_at:33:693; Interrogation_Position=1700; Antisense; TTTGATCTGCGCCTGTTTGATGAAA
>probe:Drosophila_2:1632151_at:47:201; Interrogation_Position=1806; Antisense; AACCCCAGGAAGTTCTCAGTGTGGA
>probe:Drosophila_2:1632151_at:251:191; Interrogation_Position=1838; Antisense; AACTTTGGCCAAGAGCACAGCCTGA
>probe:Drosophila_2:1632151_at:111:79; Interrogation_Position=1863; Antisense; AGGGCAGCATTGAGCTCAAGCACCC
>probe:Drosophila_2:1632151_at:136:367; Interrogation_Position=1890; Antisense; GAATCTGCAACGGAGTGGCCTTATG
>probe:Drosophila_2:1632151_at:166:241; Interrogation_Position=1940; Antisense; AATAGCCCCAGATCCATTGTAAGCA
>probe:Drosophila_2:1632151_at:187:493; Interrogation_Position=1958; Antisense; GTAAGCAGTGGTCCCAGTGAACCTG
>probe:Drosophila_2:1632151_at:199:501; Interrogation_Position=1982; Antisense; GTCGTGCCCGGCGAGTTCGTAAAGT
>probe:Drosophila_2:1632151_at:506:433; Interrogation_Position=2028; Antisense; GAGTGCACTTTCCAAGGAGACCCAA
>probe:Drosophila_2:1632151_at:520:369; Interrogation_Position=2072; Antisense; GAATGGAGCACGGTTTTCAAGCCCC
>probe:Drosophila_2:1632151_at:713:707; Interrogation_Position=2087; Antisense; TTCAAGCCCCTGCTGGGTGAACTGA
>probe:Drosophila_2:1632151_at:167:533; Interrogation_Position=2101; Antisense; GGGTGAACTGACCTTCAGCTTTGGC

Paste this into a BLAST search page for me
ATCTGCACAAGATTCGAGCGCCCGTTTGGCAGCTGCGAGGGATTTGATCTTTTGATCTGCGCCTGTTTGATGAAAAACCCCAGGAAGTTCTCAGTGTGGAAACTTTGGCCAAGAGCACAGCCTGAAGGGCAGCATTGAGCTCAAGCACCCGAATCTGCAACGGAGTGGCCTTATGAATAGCCCCAGATCCATTGTAAGCAGTAAGCAGTGGTCCCAGTGAACCTGGTCGTGCCCGGCGAGTTCGTAAAGTGAGTGCACTTTCCAAGGAGACCCAAGAATGGAGCACGGTTTTCAAGCCCCTTCAAGCCCCTGCTGGGTGAACTGAGGGTGAACTGACCTTCAGCTTTGGC

Full Affymetrix probeset data:

Annotations for 1632151_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720