FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632154_at:

>probe:Drosophila_2:1632154_at:573:425; Interrogation_Position=2622; Antisense; GAGAGTACTCAACAAATCACCCATT
>probe:Drosophila_2:1632154_at:717:135; Interrogation_Position=2708; Antisense; ACGACACCATCAAGGGCTGCTACGA
>probe:Drosophila_2:1632154_at:539:619; Interrogation_Position=2725; Antisense; TGCTACGAGTCCATGCACTGCAAGG
>probe:Drosophila_2:1632154_at:202:285; Interrogation_Position=2803; Antisense; CTGAGTTCCAACTGCTACGAGAGTA
>probe:Drosophila_2:1632154_at:90:427; Interrogation_Position=2821; Antisense; GAGAGTATCTCCCACATCCGGAGAA
>probe:Drosophila_2:1632154_at:111:135; Interrogation_Position=2857; Antisense; ACTACTCAAAATCAGGGCCACGGTT
>probe:Drosophila_2:1632154_at:52:541; Interrogation_Position=2878; Antisense; GGTTCGGCGGGCAGTTGCATCCAAC
>probe:Drosophila_2:1632154_at:455:5; Interrogation_Position=2922; Antisense; ATTGACAATCTCCTCGGATCACAAG
>probe:Drosophila_2:1632154_at:39:189; Interrogation_Position=2950; Antisense; AACAGCCTGTATGAATCCTCTCTGG
>probe:Drosophila_2:1632154_at:616:265; Interrogation_Position=3018; Antisense; CAGGTCGTCCTTGGGCAGTAGTGCC
>probe:Drosophila_2:1632154_at:449:657; Interrogation_Position=3072; Antisense; TAAGAGATCCTCAATAGCCGGCTCC
>probe:Drosophila_2:1632154_at:339:255; Interrogation_Position=3102; Antisense; CAACAGCGATGCGTGGGTGGACATT
>probe:Drosophila_2:1632154_at:361:3; Interrogation_Position=3139; Antisense; ATTGGCCAGGCGACGACCGATGCGA
>probe:Drosophila_2:1632154_at:64:255; Interrogation_Position=3168; Antisense; CAACGAGGCCCAGTTCATTGTGTAA

Paste this into a BLAST search page for me
GAGAGTACTCAACAAATCACCCATTACGACACCATCAAGGGCTGCTACGATGCTACGAGTCCATGCACTGCAAGGCTGAGTTCCAACTGCTACGAGAGTAGAGAGTATCTCCCACATCCGGAGAAACTACTCAAAATCAGGGCCACGGTTGGTTCGGCGGGCAGTTGCATCCAACATTGACAATCTCCTCGGATCACAAGAACAGCCTGTATGAATCCTCTCTGGCAGGTCGTCCTTGGGCAGTAGTGCCTAAGAGATCCTCAATAGCCGGCTCCCAACAGCGATGCGTGGGTGGACATTATTGGCCAGGCGACGACCGATGCGACAACGAGGCCCAGTTCATTGTGTAA

Full Affymetrix probeset data:

Annotations for 1632154_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720