Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632155_at:

>probe:Drosophila_2:1632155_at:496:495; Interrogation_Position=2989; Antisense; GTCTACTTTAGTCGTTTAGCCGCAC
>probe:Drosophila_2:1632155_at:404:697; Interrogation_Position=3004; Antisense; TTAGCCGCACAAAACGTACTCGTAA
>probe:Drosophila_2:1632155_at:695:401; Interrogation_Position=3044; Antisense; GACATATGAAGCAATAGCCGCCGAA
>probe:Drosophila_2:1632155_at:705:31; Interrogation_Position=3076; Antisense; ATAACCGATGATAACCTACAGCAAT
>probe:Drosophila_2:1632155_at:268:531; Interrogation_Position=3121; Antisense; GGGTACATTCTGCAGAAAGCTCTTT
>probe:Drosophila_2:1632155_at:33:279; Interrogation_Position=3139; Antisense; GCTCTTTTCAAAATTTACCTTCGAT
>probe:Drosophila_2:1632155_at:89:131; Interrogation_Position=3155; Antisense; ACCTTCGATCGATTATGCTATTTTT
>probe:Drosophila_2:1632155_at:262:55; Interrogation_Position=3185; Antisense; ATGAGCTATATATGTCCAGAACCCC
>probe:Drosophila_2:1632155_at:141:231; Interrogation_Position=3240; Antisense; AATGTCGTGATAGTAGCAGCTTGCG
>probe:Drosophila_2:1632155_at:181:365; Interrogation_Position=3264; Antisense; GAATTTGTCTGCTAGCTCGTATCTA
>probe:Drosophila_2:1632155_at:546:31; Interrogation_Position=3302; Antisense; ATAACTCCCTCCTACTTGATTATGT
>probe:Drosophila_2:1632155_at:374:681; Interrogation_Position=3384; Antisense; TATGCATTGATGTCCTTGATTTACA
>probe:Drosophila_2:1632155_at:480:205; Interrogation_Position=3478; Antisense; AAGCTTCGTCGGAGATCGTGTTCGT
>probe:Drosophila_2:1632155_at:714:715; Interrogation_Position=3498; Antisense; TTCGTTGTAGAGAACCCAGATGCAA

Paste this into a BLAST search page for me
GTCTACTTTAGTCGTTTAGCCGCACTTAGCCGCACAAAACGTACTCGTAAGACATATGAAGCAATAGCCGCCGAAATAACCGATGATAACCTACAGCAATGGGTACATTCTGCAGAAAGCTCTTTGCTCTTTTCAAAATTTACCTTCGATACCTTCGATCGATTATGCTATTTTTATGAGCTATATATGTCCAGAACCCCAATGTCGTGATAGTAGCAGCTTGCGGAATTTGTCTGCTAGCTCGTATCTAATAACTCCCTCCTACTTGATTATGTTATGCATTGATGTCCTTGATTTACAAAGCTTCGTCGGAGATCGTGTTCGTTTCGTTGTAGAGAACCCAGATGCAA

Full Affymetrix probeset data:

Annotations for 1632155_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime